FastQCFastQC Report
Mon 5 Feb 2018
NR006_S3_L001_R1_001_val_1_val_1.fq.gz

Summary

[OK]Basic Statistics

MeasureValue
FilenameNR006_S3_L001_R1_001_val_1_val_1.fq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3315665
Sequences flagged as poor quality0
Sequence length20-151
%GC37

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGT59140.17836542594019603TruSeq Adapter, Index 6 (100% over 50bp)
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA33270.10034186203974164No Hit

[OK]Adapter Content

Adapter graph