1. My results show that one of the calcification proteins, gigasin-2, in Pacific oysters is expressed less in the oysters that were left out of water for a 24 hour period. As other studies show, the process of calcification is decreased in oysters due to low pH seawater conditions. Therefore, my results may be an effect due to the build up of CO2 in oysters when they are left out of the water, thus more acidic conditions. Another explanation can be drawn from a small sample number. After several challenges with the experimental design and sampling, I ended up analyzing 9 samples from approximately 4 different oysters. This means that some of the oysters may have had less expression of the gene normally. On the other hand, some of the oysters may have been in the process of maturation and growth were experiencing higher levels of gigasin-2 gene expressing for those purposes.
2. Our research group encountered an obstacle with when we began our experimental setup. The design originally had two treatment groups, one control with seawater and the other group in water infused with CO2 to lower the pH. Both groups started with an even number of oysters that were to be observed and monitored for 6 days. The problem arose after the first 24 hours when the majority of the oysters in low pH group were found dead. The samples of the low pH group were taken after the first day and only the “control” group was carried out for the remainder of the experiment. This affected my results because I only worked with mantle samples, since that is the tissue where calcifying proteins are most often found, and mantle sample were not obtained from the low pH group, so I didn’t have a treated group to compare to the “control” group.-
The other obstacle arose when we dissected and sampled the Pacific oysters from the “control” group. Since we had several different oyster groups (triploid versus diploid and wet versus dry osters) as well as several different people taking gill and mantle samples, the labeling was mixed up with several of the mantle samples. This may have impacted my results because I it limited the number and groups of mantle samples I was able to analyze. Therefore, the fewer number of individuals analyzed, rather than an average taken from a larger group and variety, may have influenced the results.
3. I specifically examined the impacts on calcification of tidal conditions by leaving some of the oysters out of the water near the end of the experiment, as in a low tide situation. One of the calcifying proteins experienced less gene expression in oysters that were left out of the water. This is due to the build up of CO2 in their shells, which in turn makes them more acidic. It has been shown in studies, as well as being shown in my research, that low pH seawater lowers the rate of calcification in oysters and in time, their shells dissolve. Thus this research is important in showing that the currently lowering pH seawater in the Puget Sound, as well as other areas around the world, is having a negative impact on the marine wildlife. Even though a decline in the oyster population may not be a major concern, this may have other implications and lead to an imbalanced ecosystem.
4. I am stumped on trying to find articles or other studies that use the gigasin-2 gene expression to examine calcification. The gigasin-2 primer design and the genes role in oysters were based off of the NCIB primer database and Uniprot archive. However, I don’t know how big of a role this protein plays in calcification or if the decrease of calcification can be determined by the decrease in the gigasin-2 gene expression alone. I would imagine that there are other genes that play a major role in the process. I think that at this time, or until more studies are conducted on calcification in bivalves, I will not be able to find the answer to my questions about the gigasin-2 protein.-
5.In the article by D. Fang et al., titled Identification of Genes Directly Involved in Shell Formation and Their Functions in Pearl Oyster, the process of calcification is discussed. The article describes that the mantle of Crassostrea gigas is largely involved in calcification and shell formation. Consequently this tissue contains the major proteins that regulate the biomineralization process in Pacific oysters.
Another useful resource was Impact of elevated CO2 on shellfish calcificationwhich discusses how Crassostrea gigas are calcifying organisms that depend on the saturation of carbonate in seawater for survival. The Pacific oyster shells are composed of approximately 90% calcium carbonate. The calcium carbonate is produced within the oyster through the chemical reaction of carbonate and calcium ions. The saturation of carbonate within the seawater is important for C. gigas to prevent a significant decrease in calcification leading to dissolved shells. One documented cause of lowered carbonate levels in the seawater includes high atmospheric carbon dioxide, which is absorbed into the ocean and reacts with water to yield hydrogen ions and bicarbonate molecules. The higher level of dissolved carbon dioxide, and thus more acidic water, leads to a lower concentration of carbonate.
Resources:
Fang D, Xu G, Hu Y, Pan C, Xie L, et al. (2011) Identification of Genes Directly Involved in Shell Formation and Their Functions in Pearl Oyster, Pinctada fucata. PLoS ONE 6(7): e21860. doi:10.1371/journal.pone.0021860
Gazeau, F., C. Quiblier, J. M. Jansen, J.-P. Gattuso, J. J. Middelburg, and C. H. R. Heip (2007). Impact of elevated CO2 on shellfish calcification, Geophys. Res. Lett., 34, L07603, doi:10.1029/2006GL028554
> November 22, 2011
Summary
The purpose of this lab was to conclude the sample analysis for our ocean acidification research project. I ran qPCR with C. gigas mantle samples.
Method
>Quantitative PCR Procedure:
- Reconstitute new primers (unless you are reusing the previously ordered primers).
Primers used:
Gigasin-2 F: CCACCCCTTTGTTTATTCGGC
Tm= 53.99°C, G/C%: 52, 39.5nm=0.25mg
Gigasin-2R: GTTCTGAGCTGTGTGCGCT
Tm=58.3°C, G/C %: 58 4.50D=26.9 nm= 0.16 mg
- Prepare master mix according to the following recipe (Multiplied this recipe to ensure I had enough for 40 reactions + 1 for pipetting error)
| Component |
Volume (uL) |
Final Concentration |
| Master Mix, 2x (immomix) |
12.5 |
1x |
| Syto- 13 dye (50uM) |
1 |
2uM |
| Upstream primer, 10uL |
1.25 |
2.5uM |
| Downstream primer, 10uM |
1.25 |
2.5uM |
| Ultra pure water |
7 |
NA |
- Add Master mix to wells of a white PCR plate (My samples were placed in the order of cDNA, cDNA, negative control followed by negative control).
- Thaw cDNA samples and add 2uL of each cDNA template to the separate wells. Repeat this in order to make duplicate reactions for each cDNA sample.
- Add 2uL of ultra pure water to the four negative control wells and cap the wells securely.
- Spin strips.
- Ensure the lids are clean and place strips on ice.
- Load the plate and verify the PCR conditions. Start the run.
Results
Results are still pending.
Conclusion
I have not received the results from the qPCR procedure. Based on the previous PCR procedures, I predict that the gigasin-2 gene will be amplified in these C. gigas mantle samples. Based on these results I will be able to analyze the response of C. gigas to low pH situations and if they continue to express gigasin-2, a protein used in calcification.
Reflection
The purpose of this lab was to finish the lab work for our research projects. I performed qPCR in order to measure the amplification of the gigasin-2 gene in mantle samples of C. gigas. I will use these measurements to see if this protein is being expressed when the oyster was placed in low pH conditions.
> November 21, 2011
Summary
The purpose of this lab was to run a PCR with two of the C. gigas mantle cDNA samples. I also made an agarose gel and did electrophoresis to view the amplification
Method
>Agarose Gel Pouring Procedure
- In a 1L flask mix 2g of agarose and mix with 150ml 1x TAE.
- Microwave solution for approximately 3 minutes making sure it does not boil over. The solution should be clear with no precipitate or bubbles.
- Let solution cool to touch and add 12uL ethidium bromide (EtBr). Handle ethidium bromide carefully and wear gloves, as it is a carcinogen.
- Add gel combs and with a clean pipette tip, pop any bubbles that will be in the way of the PCR product.
- After gel is set, wrap in plastic and label with initials and date. Store the gel in the fridge until needed.
> Electrophoresis:
- Place agarose gel (<1.5% agarose, ETBr) in a gel box and fill with enough 1x TAE buffer to fully cover the wells and remove combs from wells.
- Load 7uL of 100bp ladder in far left lane.
- Load 25uL of each PCR sample into the gel and store remaining sample at -20°C. I had 4 PCR samples total, including two negative controls.
- Run gel at approximately 100V for 1hour. In this lab the procedure worked much faster and was only ran for approximately 30-45 minutes.
- When complete, view the gel on the UV transilluminator and determine whether the PCR amplification was successful or contaminated.
> PCR procedure:
Primer used: 80477620, S. White, 43671961, Gigasin-2R, Tm=58.3°C MW=5,841.8, 4.50D=26.9 μl= 0.16 mg
- Spin down dry primer
- Add 269μl of TE buffer (pH 8.5)- 100μm
- Incubate at 35°C for 10 minutes
- Vortex
- Spin
- Dilute to 10μm by adding 10μl of the 100μm solution and 90μL of H2O to create a working stock solution, in 1.5 ml microcentrifuge tube (RNAse free) labeled AT/ LT 10μm 10/25
- Next create a master mix by adding the following solutions to 1.5 ml microcentrifuge tube labeled MM, AT/LT:
- 10μmprimer- 1ml (x 5 for this lab= 5 ml)
- 2x GoTaq- 25μl (x 5 = 125μl)
- H2O- 21μl (x 5= 105μl)
- Pipette 48μl of master mix into each of the 0.5ml PCR tubes
- Add 2μl of the cDNA (we used the cDNA sample created in lab 3 labeled LT 10/25) to 2 of the PCR tubes. Add 2μl H2O to one of the PCR tubes that does not contain cDNA and add 2μ cDNA from a different group to one of the other PCR tubes that has not already received H2O or cDNA. The tube with H2O and the tube with cDNA from a different group will serve as controls. The fifth PCR tube is present in case of a pipetting error.
- Spin tubes and place in thermocycler.
- Run samples through thermocycler and store at -20°C afterwards.
Results
The first column on the gel is the ladder and the following two have the reactions that contained C. gigas mantle cDNA samples. The last two columns were the negative controls, which do not show primer dimer.
Conclusion
With these results I will be able to continue using these primers in the next lab session and do not need to dilute my cDNA samples because I found out that I had not diluted my forward primer in the original qPCR performed in the previous lab.
Reflection
The purpose of this lab was to determine the reason for amplification shown in the negative controls of the qPCR results. I needed to make sure there was no primer dimer for when I ran a qPCR for all of the C. gigas samples I was working with. For these purposes I performed PCR and I made an agarose gel and did electrophoresis to view the amplification from the PCR.
> November 15, 2011
Summary
In this lab we went through a DNA dilution and the Cystosine Methylation Dot Blot procedure where I used Salina’s C. gigas gill 2n DNA sample. Next we went through the qPCR procedure with two of the C. gigas cDNA samples that I created last week (45mg 2n W and 20mg 3n W) using the reverse and forward primer for gigasin-2.
Method
> Methylation Cytosine Dot Blot:
DNA Dilution:
- First dilute DNA sample (C. gigas gell 2n) to achieve a 50ng/uL concentration. The original concentration of the DNA sample was 158.3ng/uL, so using the M1V1=M2V2 equation we calculated that 27.4uL of H2O needed to be added.
- Label 5 screw cap tubes (if snap cap tubes are used then the caps pop open in the boiling step) with “AMT DNA” and the target concentration.
- Prepare 5 dilutions of DNA sample, one of each target concentration using the following instructions. Each dilution should add up to a total volume of 200uL in each.
| Dilution |
Target Concentration |
H2O (uL) |
20x SSC (uL) |
50ng/uL DNA sample (uL) |
| 1 |
0.8ng/uL |
124 |
60 |
16 |
| 2 |
0.4ng/uL |
132 |
60 |
8 |
| 3 |
0.2ng/uL |
136 |
60 |
4 |
| 4 |
0.1ng/uL |
138 |
60 |
2 |
| 5 |
0.05ng/uL |
139 |
60 |
1 |
Dot Blotting:
- Cut nylon membrane to fit 72 wells of manifold.
- Soak the nylon membrane for 10 min in 6x SSC (enough to cover the membrane) in top of tip box.
- Cut filter paper to the size of the membrane and wet in 6x SSC.
- Next assemble the manifold with the membrane lying on top of the filter paper.
- Denature the DNA dilutions by boiling in water for 10 minutes and transfer to ice. Then spin down for 5 minutes.
- Switch on the vacuum and apply 500uL of 6x SSC to each well and allow the SSC to filter through.
- Apply entire DNA sample to wells without touching the wells with the pipette tip and record where your samples were placed.
- Allow sample to filter through and soak filter paper cut to size in denaturation buffer.
- Once filtration of the samples through the nylon membrane is complete, dismantle manifold and transfer membrane to the filter paper soaked in denaturation buffer and let sit for 5 minutes.
- Place membranes on dry filter paper and let dry.
- Wrap dried blot in plastic wrap and place DNA-side-down for 2 minutes on UV transluminator at 120kJ in order to immobilize the DNA.
Chromogenic immunodetection:
Cautions:
>Work quickly when changing solutions as membranes dry quickly and only touch the membrane with forceps.
>Add solutions to trays slowly, and at the edge of the membrane to prevent bubbles forming underneath the membrane. Decant from the corner of the dish to ensure complete removal of previous solutions.
- Begin procedure by preparing 20mL of blocking solution.
Ultra filtered water 14mL
Blocker/diluent (part A) 4mL
Blocker/diluent (part B) 2mL
- Place membrane in a covered, plastic dish of 10mL of blocking solution and incubate on a rotary shaker set at 1 rev/sec for 30 minutes.
- Decant the blocking solution and rinse the membrane for 5 min with 20 mL of water, then decant and repeat.
- Prepare 10mL of Primary Antibody Solution (1:5000 dilution) as follows:
Blocking Solution 10mL
5-MeC antibody 2uL
- Incubate the membrane for 1 hour with 10 mL of the Primary Antibody Solution. Prepare qPCR at this time.
- Decant the Primary Antibody Solution and wash the membrane with 20 mL of TBS-T for 5 minutes then decant and repeat three times.
- Incubate the membrane for 30 minutes in 10mL of secondary antibody solution and decant.
- Wash the membrane with 20 mL of TBS-T for 5 minutes and decant and repeat three times.
- Rinse the membrane with 20mL of water for 2 minutes and decant. Repeat this step twice.
- Incubate the membrane until color begins to develop (1-60 minutes) while membrane is in 5mL of Chromogenic Substrate.
- Rinse the membrane with 20mL of water for 2 minutes and decant. Repeat twice.
- Dry membrane on a clean piece of filter paper.
>Quantitative PCR Procedure:
- Reconstitute new primers (unless you are reusing the previously ordered primers).
Primers used:
Gigasin-2 F: CCACCCCTTTGTTTATTCGGC
Tm= 53.99°C, G/C%: 52, 39.5nm=0.25mg
Gigasin-2R: GTTCTGAGCTGTGTGCGCT
Tm=58.3°C, G/C %: 58 4.50D=26.9 nm= 0.16 mg
- Prepare master mix according to the following recipe (Multiplied this recipe by 5 to ensure I had enough for 4 reactions + 1 for pipetting error)
| Component |
Volume (uL) |
Final Concentration |
| Master Mix, 2x (immomix) |
12.5 |
1x |
| Syto- 13 dye (50uM) |
1 |
2uM |
| Upstream primer, 10uL |
1.25 |
2.5uM |
| Downstream primer, 10uM |
1.25 |
2.5uM |
| Ultra pure water |
7 |
NA |
- Add Master mix to wells of a white PCR plate (My samples were placed in the order of cDNA, cDNA, negative control followed by negative control).
- Thaw cDNA samples and add 2uL cDNA template to each reaction.
- Add 2uL of ultra pure water to the negative control wells and cap the wells securely.
- Spin strips.
- Ensure the lids are clean and place strips on ice.
Load the plate and verify the PCR conditions. Start the run.
Results
The primers worked very well as the DNA was amplified. The negative controls showed some amplification, though not much. This was unexpected.
Conclusion
The small amplification of my two negative control samples may have been caused by contamination or by primer dimer. Also the DNA was amplified a little too well and I will need to dilute the cDNA samples for the next run. I will be performing PCR with my samples before the next scheduled lab in order to find the cause of the amplified negative controls.
Reflections
The purpose of this lab was to practice the techniques of PCR and epigenetics analysis. We performed quatitative PCR, which proved to also be a good practice run for our primers that will also be used for our group research project analysis. This procedure measures the amplification of one or more specific sequences in a DNA sample. In addition, we measured DNA methylation by doing a Cytosine Methylation Dot Blot.
>November 11, 2011, Lab 6 continued
Summary
This was a continuation of lab 6. I used the RNA extraction samples from 11/8 to do RNA quantification and then perform reverse transcription to get a more stable cDNA sample for the PCR procedure we will be doing in lab 7.
Method
>RNA Quantification:
-Let RNA samples thaw and centrifuge briefly.
-Keep RNA samples on ice before and after measurement of RNA concentration.
-Create a blank on the nanodrop spectrophotometer by pipetting 2uL of 0.1% DEPC-H2O onto the nanodrop pedestal and lower the arm.
-Click “blank” and once the nanodrop spectrophotometer is done setting the blank.
-Clean the upper and lower arm of the pedestal with a KimWipe.
-Pipette 2uL of the RNA samples onto the Nanodrop pedestal and lower the arm. Click “Measure”.
-Record the RNA concentration (ng/uL) and A260/280 ratio for each sample.
-Repeat the previous three steps for each RNA sample.
Measurements:
29mg 2n D= 396.9ng/uL, A260/280: 1.88
44mg 2n W= 2071.7ng/uL, A260/280: 1.90
36mg 2n D= 757.2ng/uL, A260/280: 1.83
30mg 2n D= 1457.0ng/uL, A260/280: 1.93
38mg 2n D= 803.6ng/uL, A260/280: 1.93
34mg 2n W= 2070.0ng/uL, A260/280: 1.91
55mg 3n W= 899.0ng/uL, A260/280: 1.83
45mg 2n W= 899.0ng/uL, A260/280: 1.88
25mg 3n W= 296.3ng/uL, A260/280: 1.86
>Reverse transcription:
-Invert RNA samples several times.
-In 0.5mL PCR tubes labeled cDNA AT with tissue weight, combine the following:
5uL of RNA sample
1uL of oligo dT
4uL of nuclease free H2O
-Briefly centrifuge
-Incubate tubes for 5 min at 70°C on the thermocycler and briefly centrifuge and put samples on ice for a few minutes.
-Add the following solutions to PCR tubes:
5uL of M-MLV 5X Reaction Buffer
5uL of dNTPs
1uL of M-MLV RT
4uL of nuclease free H2O
-Briefly centrifuge samples and incubate for 60 min at 42°C and then heat inacticate at 70°C for 3 min on thermocycler
-Spin down the sample in a desktop centrifuge
-Store at -20°C.
Results
RNA Quantification Results:
29mg 2n D= 396.9ng/uL, A260/280: 1.88
44mg 2n W= 2071.7ng/uL, A260/280: 1.90
36mg 2n D= 757.2ng/uL, A260/280: 1.83
30mg 2n D= 1457.0ng/uL, A260/280: 1.93
38mg 2n D= 803.6ng/uL, A260/280: 1.93
34mg 2n W= 2070.0ng/uL, A260/280: 1.91
55mg 3n W= 899.0ng/uL, A260/280: 1.83
45mg 2n W= 899.0ng/uL, A260/280: 1.88
25mg 3n W= 296.3ng/uL, A260/280: 1.86
The concentrations of each sample are pretty high and the A260/280 ratio gives us an idea of the purity of the samples. The 260/280 ratios are all acceptable values.
Conclusion
These results are as to be expected and based on these results, the samples are acceptable to continue with for reverse transcription and further analysis.
Reflection
The purpose of this lab was to finish preparing our C. gigas mantle samples for PCR. I performed RNA quantification to measure the RNA concentration and purity in each of my samples. Then I performed reverse transcription to get cDNA samples from the RNA samples, which are more stable to withstand the PCR procedure.
> November 8, 2011, Lab 6
Summary
In this lab we began the steps for data analysis of our ocean acidification oyster experiment samples. I specifically worked with the oyster mantle samples and isolated and extracted RNA.
Method
>RNA Isolation:
-Weigh all mantle samples and cut them with razor to achieve necessary weight (between 20-50mg) and place in snap cap tubes labeled with tissue weight, 2n or 3n.
My samples (C. gigas, mantle):
29mg 2n D
44mg 2n W
36mg 2n D
30mg 2n D
38mg 2n D
34mg 2n W
55mg 3n W
45mg 2n W
25mg 3n W
-Add 500uL of TriReagent to each of the 1.5mL snap cap tube containing the tissues.
-Carefully homogenize the tissues using a disposable pestle. Be sure to either use a new pestle for each sample or sterilize by first dipping into bleach and then ethanol.
-Add another 500uL of TriReagent to the tube and vortex vigorously for 15s.
- Store samples on ice until ready for RNA extraction
>RNA Extraction:
- Incubate homogenized tissue samples
- Add 200μL of chloroform to each tissue sample. Use this chemical cautiously under fume hood and close caps as soon as the needed quantity is delivered.
- Vortex on a high setting for 30 seconds or until the solution appears milky.
- Incubate sample for five minutes at room temperature.
- Spin sample at maximum speed in a refrigerated microfuge for fifteen minutes. Be sure to remove tubes carefully as to not disturb the contents of the tube.
- Transfer the clear portion on the top of the samples (aqueous phase) into snap cap tubes, without pipetting any of the white cell debris (interphase), label tubes with initials, weight of sample, 2n or 3n and W or D.
- For the duration of the lab procedure, use the tubes containing the aqueous phase sample and properly dispose of the tube with the interphase and organic phase.
- Add 500μL of isopropanol to each sample and invert several times until solution is constant and no longer “lumpy.”
- Incubate for ten minutes at room temperature.
- Spin at maximum speed in a refrigerated microfuge for eight minutes. This should result in a small white pellet (RNA and salts) at the bottom of the samples.
- Remove supernatant.
- Add 1mL of 75% EtOH to pellet and vortex tubes briefly to free the pellet from the bottom of the tubes.
- Spin samples in microfuge for five minutes at 7500g. At this point in the procedure the microfuge may be at room temperature.
- Remove supernatant very carefully without removing any tissue from the pellet. Dry pellet as best as possible. Dry pellet by incubating with cap open for less than five minutes and lightly pat dry with KimWipes.
- Add 100μL of 0.1% DEPC-H2O and dissolve pellet by pipetting up and down. To help dissolve the RNA you may need to incubate tube at 55°C, but this was not necessary for my samples in this lab.
Results
No results were obtained on this day, see results from 11/ 11 to view the RNA quantification for these samples.
Conclusion
The next step will be RNA quantification for each of these RNA samples and then reverse transcription to obtain a more stable cDNA sample for PCR.
Reflection
The purpose of this lab was to prepare our experiment samples for analysis so that we can study the effect of ocean acidification on oysters. Specifically, I am using these samples to look at the gene expression for a protein used in the process of calcification, gigasin-2. This lab included the beginning steps of RNA isolation and extraction, which will help me to measure gene expression in these C. gigas mantle samples.
>November 1, 2011, Lab 5
Summary:
In this lab I extracted protein from a C. gigas mantle sample collected from our ocean acidification experiment. This sample was collected from a farmed C. gigas (triploid) and was in the controlled experiment group (kept in natural seawater for six days. After extracting protein the protein sample was used for SDS-PAGE; a procedure to separate proteins based on molecular weight. This sample was then used for a western blot. In addition to the work done with protein, we ran the cDNA from the C. gigas gill tissue from the previous lab on an agarose gel and analyzed it using an electrophoresis procedure.
Materials & Method:
>Agarose Gel Pouring Procedure (This task was completed by lab instructor before lab)
- 1L flask
- Agarose
- 1x TAE
- Ethidium bromide
- Microwave
- Gel rigs
- Kimwipes
- In a 1L flask mix 2g of agarose and mix with 150ml 1x TAE.
- Microwave solution for approximately 3 minutes making sure it does not boil over. The solution should be clear with no precipitate or bubbles.
- Let solution cool to touch and add 12uL ethidium bromide (EtBr). Handle ethidium bromide carefully and wear gloves as it is a carcinogen.
- Add gel combs and with a clean pipette tip, pop any bubbles that will be in the way of the PCR product.
- After gel is set, wrap in plastic and label with initials and date. Store the gel in the fridge until needed.
> Electrophoresis:
- Place agarose gel (1.5% agarose, ETBr) in a gel box and fill with enough 1x TAE buffer to fully cover the wells and remove combs from wells.
- Load 7uL of 100bp ladder in far left lane.
- Load 25uL of each PCR sample into the gel and store remaining sample at -20°C. We had 4 PCR samples total, including two negative controls.
- Run gel at approximately 100V for 1hour. In this lab the procedure worked much faster and was only ran for approximately 30-45 minutes.
- When complete, view the gel on the UV transilluminator and determine whether the PCR amplification was successful or contaminated.
>Protein Extraction:
- Weigh sample (3n wet C. gigas mantle, 0.020g)
- Labeled snap cap tubes with date and initials.
- Add 500uL of CelLytic MT to tissue and homogenize in 1.5mL snap cap tube.
- Spin tube for 10 minutes in microfuge at max speed.
- Label new snap cap with “Protein” and C. gigas mantle 3n wet and transfer supernatant into this tube.
- Store this “Protein” tube on ice until needed.
> SDS- Polyacrylamide Gel Electrophoresis:
- 1.5 mL screw cap tubes
- Sterile gel loading tips (substitute sterile filter pipette tips (1-1000uL)
- Microcentrifuge tube rack
- Timers
- Heating block with water bath
- Tube “floatie”
- Glass container for boiling water to accommodate “floatie”
- Protein gel box (SR provided)
- SDS/PAGE gels
- Trays for staining gels
- Power supply
- Platform rocker/shaker
- Plastic wrap
- 2x SDS reducing sample buffer
- Protein ladder marker
- Begin boiling water on hot plate
- Thaw protein extract. (This sample was created in this lab and did not need to be thawed.
- Mix by inverting several times.
- In a new 1.5mL screw cap tube add 15uL of protein stock and 15uL of 2x Reducing Sample Buffer and return protein stock to -20°C freezer.
- Flick sample a few times to mix and centrifuge for 10 seconds.
- Boil sample for 5 minutes and observe assembly of gel box and rinse gel wells by pipetting the buffer solution up and down in the well.
- Centrifuge sample for 1 minute when finished boiling and slowly load entire sample into a well.
- Place lid on gel box and set up to electrodes and power supply.
- Turn Power supply on and run for 45 minutes at 150 V.
- Check agarose gel results and set up for western blot.
- Turn off power supply, unplug gel box and remove lid from gel box.
- Disengage the tension wedge and remove gel.
- Crack open cassette to expose gel and trim wells at top of gel. Notch one of the corners of the gel to help with orientation later (we notched the top right corner).
- Continue with Western Blotting procedure.
> WesternBreeze Chromogenic Western Blot Immunodetection:
- Nanopure water
- Gel straining tray
- Blocking solution
- Rotary shaker
- Primary antibody solution
- Antibody wash
- Secondary antibody solution
- Chromogenic substrate
- Timers
- SDS-PAGE gel
- Tris-Glycine transfer buffer
- Filter paper
- Nitrocellulose membrane
- Semi-dry transfer station
- Gel running buffer
- Light box
- Digital camera
- Soak filter paper, membrane and gel in Tris-Glycine transfer buffer for 15 minutes.
- Assemble blotting layers in the semi-dry blotting apparatus as follows:
Anode
Filter paper
Gel
Filter paper
Cathode
- Transfer the blot at 20 V for 30 minutes.
- Remove gel from the sandwich and rinse off adhering pieces of gel with transfer buffer (This step and the following steps were performed by the TA after lab hours).
- Wash membrane with 20uL of pure water for 5 minutes and repeat.
Put the membrane in the plastic box and add 10mL of Blocking solution. Then cover and incubate overnight on a rotary shaker set at 1 revolution/second.
- Decant liquid and rinse the membrane with 20 mL of water for 5 minutes and decant again. Repeat.
- Incubate the membrane in 10 mL of Primary antibody solution.
- Decant liquid and rinse the membrane with 20 mL of Antibody wash for 5 minutes and decant again. Repeat this step 3 times.
- Incubate the membrane for 30 minutes in 10 mL of Secondary antibody solution.
- Decant liquid and rinse the membrane with 20 mL of Antibody wash for 5 minutes and decant again. Repeat this step 3 times.
- Incubate in 5mL of chromogenic substrate until a purple band appears between 1-60 minutes after adding the solution.
- Dry the membrane on a clean piece of filter paper to the open air.
Results:
The results of the PCR analysis through electrophoresis with the agarose gel were not as expected. Len and my PCR samples were placed in the first through fourth well after the ladder, in the order of sample (1st), negative control (2nd), sample (3rd) and negative control (4th). One of the negative controls was contaminated while the other was faint, however, the other two PCR samples were amplified successfully and were sized at about 200-300 bp.
The SDS-PAGE analysis, with my sample placed in the first visible column on the left, shows one larger band, which is not very distinct. When this gel was then used in the Western Blot procedure, the results show that none of the Hsp70 protein was transferred.
Conclusion:
For the most part, these results were not as to be expected. We had contamination in the PCR procedure and the Hsp70 protein from a C. gigas mantle tissue was not marked in the Western Blot. Since this tissue is expected to contain the Hsp70 protein, the procedure or sampling may have been the reason for this result. Based on these results we need to be more careful when handling and preparing the solutions for analysis, especially with the PCR procedure.
Reflection:
The purpose of this lab was to observe and practice different techniques of data analysis including electrophoresis using an agarose gel, SDS-PAGE and Western Blot. These procedures are used to measure the success of amplification after a PCR procedure by looking at the size of the cDNA. The SDS-PAGE staining is used to analyze the expression of proteins in a sample, while the Western Blot analyses the expression of a specific protein in the sample (in our case, the Hsp70 protein). We may use some of these methods in our group research project of the effects of ocean acidification on C. gigas, as well as other studies on the physiological responses of organisms.
>October 25, 2011, Lab 4
Summary:
The purpose of this lab was to complete the sampling for our group research project, ocean acidification affects on Pacific oysters. As well as perform PCR in order to prepare for data analysis in future labs.
Materials & Methods:
Micropipettes (1-1000μL)
Sterile filter pipette tips (1-1000μL)
Tip waste jar
PCR tubes (0.5 ml; thin walled)
1.5 ml microcentrifuge tubes (RNAse free)
cDNA
2x GoTaq Green Master Mix
Primers
Nuclease Free water
Thermal cycler
Kimwipes
Microfuge tube racks
PCR tube racks ice buckets
Dry Ice
PCR procedure:
Primer used: 80477620, S. White, 43671961, Gigasin-2R, Tm=58.3°C MW=5,841.8, 4.50D=26.9 μl= 0.16 mg
- Spin down dry primer
- Add 269μl of TE buffer (pH 8.5)- 100μm
- Incubate at 35°C for 10 minutes
- Vortex
- Spin
- Dilute to 10μm by adding 10μl of the 100μm solution and 90μL of H2O to create a working stock solution, in 1.5 ml microcentrifuge tube (RNAse free) labeled AT/ LT 10μm 10/25
- Next create a master mix by adding the following solutions to 1.5 ml microcentrifuge tube labeled MM, AT/LT:
- 10μmprimer- 1ml (x 5 for this lab= 5 ml)
- 2x GoTaq- 25μl (x 5 = 125μl)
- H2O- 21μl (x 5= 105μl)
- Pipette 48μl of master mix into each of the 0.5ml PCR tubes
- Add 2μl of the cDNA (we used the cDNA sample created in lab 3 labeled LT 10/25) to 2 of the PCR tubes. Add 2μl H2O to one of the PCR tubes that does not contain cDNA and add 2μ cDNA from a different group to one of the other PCR tubes that has not already received H2O or cDNA. The tube with H2O and the tube with cDNA from a different group will serve as controls. The fifth PCR tube is present in case of a pipetting error.
- Spin tubes and place in thermocycler.
- Run samples through thermocycler and store at -20°C afterwards.
Results:
The results for the PCR procedure have not yet been obtained, but will be reported in following labs. The sampling of C. gigas was mostly successful, although some samples are mislabeled and will need to be excluded from the data analysis.
Conclusion:
I expected the sampling process to go more smoothly and did not think we would have labeling issues. This will serve as a good lesson for future sampling. We will need to look at our samples carefully next and not analyze samples that are not positively labeled correctly, as this could greatly impact the future results of our research project.
Reflection:
This lab did not contain any data analysis but was a preparation for future analysis for our group research projects. We performed PCR with primers for C. gigas proteins. This procedure will allow us to amply specific DNA fragments. By using this method, we will analyze specific gene expression in Pacific oysters.
>October 18, 2011, Lab 3
Summary:
The purpose of this lab was to perform a reverse transcription procedure with my previously extracted C. gigas RNA sample. Reverse transcriptase involves transcribing cDNA from an RNA sample. This procedure is done because cDNA can be analyzed similarly to RNA but is more stable. The remainder of this lab was spent setting up our group research project, which is a study on the physiological responses of C. gigas to ocean acidification.
Materials & Methods:
Materials-
- Micropipettes (1-1000 μl)
- Sterile filter pipette tips (1-1000 μl)
- Tip waste jar
- PCR tubes (0.5 ml; thin walled)
- RNA samples (student provided)
- M-MLV reverse transcriptase
- M-MLV 5X reaction buffer
- Oligo dT
- dNTPs
- Nuclease Free water
- thermal cycler
- microfuge tube racks
- PCR tube racks
- ice buckets
Procedure- Reverse Transcription
- Invert RNA sample from lab 2 (labeled AT 10/11) multiple times.
- Label a 0.5 mL PCR tube with “AT 10/18 cDNA” and add:
- 5μL of RNA sample
- 1μL of oligo dT
- 4μL of nuclease free H2O
- Incubate PCR tube at 70°C for 5 min. on the thermocycler then transfer to ice.
- Again briefly centrifuge the tube.
- Add to the PCR tube:
- 5μL of M-MLV 5X Reaction Buffer
- 5μL of dNTPs
- 1μL of M-MLV RT
- 4μL of muclease free H2O
- Centrifuge PCR tube and store at -20°C.
Results:
We did not perform any analysis in this lab; therefore I have no results to report.
Conclusions:
I do not have any results to reflect on. In the next lab session, however, we will begin the process of analysis of the C. gigas tissue obtained from the group research project.
Reflection:
The purpose of this lab was to expand our knowledge of techniques used to analyze organism tissue samples. The specific technique we learned in this lab is reverse transcription. This procedure has several applications including analysis of gene expression and is commonly used to obtain cDNA from RNA as that it is more stable for analysis. This lab was also used to finish designing our group research project and begin the experimental set up.
>October 11, 2011, Lab 2
Summary:
The purpose of this lab was to continue the process of RNA extraction and quantification from lab 1 on October 4th. The sample used in this lab was C. gigas gonad tissue that had been homogenized and stored in stored at -80°C for a week. Once a stock RNA sample was obtained from several microfuge spins of the homogenized gonad tissue and other extraction protocol, the RNA sample was quantified using a Nanodrop spectrophotometer.
Method:
RNA Extraction- continued-
- Incubate homogenized tissue sample from Lab 1 labeled AT JK 10/4.
- Add 200μL of chloroform to tissue sample. Use this chemical cautiously under fume hood and close caps as soon as the needed quantity is delivered.
- Vortex on a high setting for 30 seconds or until the solution appears milky.
- Incubate sample for five minutes at room temperature.
- Spin sample at maximum speed in a refrigerated microfuge for fifteen minutes. Be sure to remove carefully as to not disturb the contents of the tube.
- Transfer the clear portion on the top of the sample (aqueous phase) into a snap cap tube labeled AT 10/11, without pipetting any of the white cell debris (interphase).
- For the duration of the lab procedure, use the tube containing the aqueous phase sample and properly dispose of the tube with the interphase and organic phase.
- Add 500μL of isopropanol to the sample and invert several times until solution is constant and no longer “lumpy.”
- Incubate for ten minutes at room temperature.
- Spin at maximum speed in a refrigerated microfuge for eight minutes. This should result in a small white pellet (RNA and salts) at the bottom of the sample.
- Remove supernatant.
- Add 1mL of 75% EtOH to pellet and vortex tube briefly to free the pellet from the bottom of the tube.
- Spin sample in microfuge for five minutes at 7500g. My sample was spun in a refrigerated microfuge, although at this point in the procedure the microfuge may be at room temperature.
- Remove supernatant very carefully without removing any tissue from the pellet. Dry pellet as best as possible. Dry pellet by incubating with cap open for less than five minutes and lightly pat dry with KimWipes.
- Add 100μL of 0.1% DEPC-H2O and dissolve pellet by pipetting up and down. To help dissolve the RNA you may need to incubate tube at 55°C, but this was not necessary for my sample in this lab.
- Store RNA sample on ice between steps of RNA quantification.
RNA Quantification-
- Measure 2μL of 0.1% DEPC-H2O onto the Nanodrop pedestal and lower arm to zero the instrument.
- Pipette 2μL of RNA sample onto the Nanodrop, lower the arm and click “Measure.”
- Record RNA concentration for the A260/A280 ratio (1.74ng/μL) and for the A260/A230 ratio (1.98ng/μL) and the total concentration (3323.5ng/μL).
- Wipe off Nanodrop with a KimWipe and give RNA sample to the TA to be stored at -80°C.
Results-
The results from this two-part RNA extraction were obtained this lab. The concentration of my C. gigas gonad RNA extraction was 3323.5ng/μL. The A260/A280 ratio was measured as 1.74ng/μL and 1.98ng/μL for the A260/A230 ratio. I did not expect such a high concentration of RNA from this tissue extraction.
Conclusions-
The concentration of RNA I obtained from the extraction surprised me, as it was the highest out of the other lab samples. Since the RNA was extracted from a gonad tissue, it is not surprising that I was able to extract a high concentration, because I would assume that in general a gonad tissue would have more RNA present. Based on these results, I will be more likely to collect gonad tissue if I need to do further RNA extractions in physiological response research.
Reflection-
This lab was set up to take us through one of the many procedures for RNA extraction and quantification. The procedure performed was used to measure the concentration of RNA in a sample of a given tissue, which was a C. gigas gonad tissue in my case. This procedure was simple to execute and yielded good results. This same procedure will be helpful when our research groups need to make RNA extractions to measure the physiological response to a given environmental stress. This procedure is also very similar to the procedure used to extract DNA, which we may also need for our research projects.
>October 4, 2011, Lab 1
Summary:
The purpose of lab one was to practice extracting RNA and protein from tissue samples. In order to begin extracting RNA, TriReagent was added to a C. gigas gonad tissue in order to denature the protein of the tissue, and separates the RNA from DNA and other cellular proteins. Protein was then extracted from a C. gigas mantle sample tissue using CelLytic MT to dissociate the lipid membranes. The total protein was analyzed using the Bradford Assay and by measuring the absorbance with a spectrophotometer.
Materials and Methods:
RNA Extraction Part 1-
- Obtain tissue sample: C. gigas gonad tissue 0.0329g.
- Add 500uL of TriReagent to sample tissue in 1.5mL tube and homogenize.
- Add 500uL of TriReagent to homogenized sample and vortex.
- Store homogenized sample at -80°C until following lab.
Protein Extraction and Analysis-
- Weight of C. gigas mantle tissue sample is 0.009g.
- Labeled all snap cap tubes with date, 10/4 and initials AT.
- Add 500uL of CelLytic MT to tissue and homogenize in 1.5mL snap cap tube.
- Spin tube for 10 minutes in refrigerated microfuge at max speed.
- Label snap cap with “Protein” and C. gigas mantle and transfer supernatant into this tube.
- Store this “Protein” tube on ice.
- Label new 2nL snap cap tube with “Protein,” BA.
- Dilute protein sample 1:2 by adding 15uL of the protein sample and 15uL of DI water to the “Protein,” BA tube.
- Create a blank snap cap tube, labeled “blank,” and add 30uL of DI water.
- Add 1.5mL of Bradford reagent to both the blank and “Protein,” BA tubes.
- Invert tubes and incubate for 10minutes at room temperature.
- Transfer 1000uL of the protein sample to a cuvette and 1000uL from the blank tube to a different cuvette.
- Use the blank cuvette to zero the spectrophotometer, then measure the absorbance of the protein sample, 0.276. - what wavelength? -
- Use pipette to mix sample and measure the absorbance a second time (0.275) to obtain an average absorbance value, 0.2755.
- Calculate the protein concentration using the graph provided and the obtained absorbance value.
y= [1013.9(0.2755)]*2
y=558.7ug/mL
Results:
The results of the RNA extraction will not be obtained until lab 2. The concentration of the protein extraction was 558.7ug/mL.
Conclusion:
The result of the protein concentration is within the expected range of values based on the graph provided and standard curve. I will continue by completing the missing results for the RNA extraction.
Reflection:
This lab was designed to improve our laboratory research skills by practicing the basic techniques to extract RNA and protein from whole tissue samples. We used a spectrophotometer to measure the protein concentration in our samples, which may be a helpful tool later in the quarter when we conduct research for our projects. For instance, we could measure the protein concentration from specific tissues of our organism to help indicate how the organism reacted to an environmental stress.