12/3/12

Capstone paper working draft: Here
Data analysis: Here
  1. qPCR raw data formatted from CFX96 output to PCR miner format
  2. run on PCR miner
  3. R0 calculated (R0 = 1/(avg. efficiency of gene +1)^ avg. CT of replicate sample)
  4. R0 normalied with actin to get normalized R0 numbers (normalized R0 = R0 gene/ R0 actin)
  5. Statistics and graphs made from normalized R0
Capstone presentation: add later

10/12/12

Today: 1. Run qPCR with normalizing gene primers that worked on check gel

qPCR procedure:
Single reaction volume:
2X Sso Fast Evagreen – 10ul
Forward primer (10uM) – 0.5ul
Reverse primer (10uM) – 0.5ul
H2O – 8ul
Template – 1ul

Master mix (for 3 volumes: 1 sample mix, 1 neg. qPCR control, and 1 neg. cDNA control)
-made 4 reaction volumes
-made two seperate master mixes: a. actin primers ; b. acidic ribosomal protein primers
2X Sso Fast Evagreen – 10ul x 4 = 40ul
Forward primer (10uM) – 0.5ul x 4 = 2ul
Reverse primer (10uM) – 0.5ul x 4 = 2ul
H2O – 8ul x 4 = 32ul
1. Use white opaque well plate - 6 wells (Row A= actin master mix; B= acidic ribosomal protein master mix;; Column 1= sample mix; 2= -qPCR; 3= -cDNA)
- For -cDNA used column 5 well
- For sample mix used 1uL from each well in column 1 (8uL total)

10/2/12

Today: 1. Repeat procedure from 10/1/12 because gel did not work

Primer 3 and 4 worked on gel. Will use one of them as my normalizing gene.

10/1/12

Today: 1. Run PCR of normalizing genes 2. Check gel on PCR product


Labels: "#, letter"
1= elongation factor; 2= g3p dehydrogenase; 3= actin; 4= acidic ribosomal protein
S= sample mixture; C= cDNA negative control; P= PCR negative control

Sample mixture - mix 1uL of samples

Procedure
Make 1.3% agarose gel
1. 110uL TAE buffer with 1.4g agarose - after cool add 11uL EtBr -- note: gel partially solidified when mixing EtBr, so re-heated in microwave until fully dissolved
2. Gel poured into mold with 20 well comb
a.
3. Run for about minutes 30 at 107V

Ran gel for too long. Samples came off of the gel.

Next time: Need to redo and run sample on check gel for shorter time.

6/19/12

Today: 1. Re-suspend primer pellets 2. Make 10mM working stock primers 3. PCR subset cDNA with normalizing gene primers

Procedure:
Re-suspend primers:
1. Look at label on tube for nmol of primer in tube.
2. Spin down tubes to gather pellet on bottom of tubes.
3.. Add TE Buffer pH 8.5 (ETS 10.20.11) to primer tube
- Amount of buffer added to make 100mM solution. (uL added is 10*#nmol of primer)
Example: Ol_Arp_F - 28.6nm, add 286uL TE buffer.
4. Primer stock stored in -20C

Working stock primers:
1. Dilute from 100mM to 10mM.
2. 10uL of primer stock with 90uL of PCR water
3. Mix and spindown
-Labeled "primer name, 10mm, 6/19/12"

PCR tubes labeled - "sample/-cDNA/-PCR , PCR, gene name"


Next time: Make agarose gel and run PCR to see if normalizing gene primers are working.

6/18/12

Today: 1. Interpret qPCR results 2. create cDNA from Dnase treated RNA samples 3. Picked up normalizing gene primers
qPCR results: CFX96 file
cDNA procedure: Sheet "cDNA calculations" - cDNA reaction volumes

primers were not resuspended. stored in -20C.

Next time: Run a check gel with normalizing gene primers.

6/13/12

Today: 1. Spec all Dnase treated RNA samples 2. Design primers for O. lurida normalizing genes 3. qPCR subset of RNA samples to check if Dnase treatment was successful

Procedure:
Spec sample in two groups. a. 1-23 b. 24-44,X,0
Spec results: Sheet "6_13_12_SpecData_DnaseSamples.t" - Spec results


Normalizing genes primers: Primer information


qPCR done with subset of samples: 3G, 6G, 15G, 17G, 28G, 30G, 40G, XG
Single reaction volume:
2X Sso Fast Evagreen – 10ulkk
Forward primer (10uM) – 0.5ul
Reverse primer (10uM) – 0.5ul
H2O – 8ul
Template – 1ul

Master mix (for 11 volumes: 8 samples, 2 negative control (H2O), one positive control (pooled cDNA))
-made 12 reaction volumes
2X Sso Fast Evagreen – 10ul x 12 = 120ul
Forward primer (10uM) – 0.5ul x 12 = 6ul
Reverse primer (10uM) – 0.5ul x 12 = 6ul
H2O – 8ul x 12 = 96ul
  1. Use white opaque well plate (12 wells, 6X2) – samples arranged as follows:

 7
 8
 9
 10
 11
 12
A
 3G
 6G
 15G
 17G
 28G
 30G
B
 40G
 XG
 Neg. Con.
 Neg. Con.
 Pos. Con.
 Blank

  1. add 19ul of master mix to each tube
  2. add 1ul template to each tube: PCR H2O for negative control, pooled cDNA for positive control
    1. template samples were diluted to same mass of sample as would have been added after cDNA step. Calculations here:
    2. pooled cDNA created by adding 1ul of each cDNA sample from 5/11/12 subset (8ul total volume): mixed and spun down
    3. Cap tubes with qPCR specific caps
    4. Centrifuge plate in Sorvall for 2min at 3000g
    5. Sign up for qPCR machine use
    6. Well added to top left corner of thermal cycler [95C, 95C, 65C; 40 cycles]
    7. File saved to dropbox folder: “Roberts Lab CFX96 Data”
Expect all wells to be negative except for positive control.

Samples diluted: diluted samples stored in -20C
Pooled cDNA from 5/11 subset stored in -20C

Next time: interpret qPCR results

6/12/12

Today: Treat RNA samples with Dnase to remove residual DNA.
Procedure:
Manufacturer protocol: tools.invitrogen.com/content/sfs/manuals/cms_055740.pdf
Use 0.5ml tubes.
50ul reaction volume:
44ul of 5ug RNA + H2O - calculations here (spreadsheet called "Dnase calculations"): Dnase calculations
5ul of 10X Dnase buffer - want to add 0.1 volumes
1ul of Dnase
Split into 4 groups (all gill tissue):
a. X,0, 24-33
b. 34-44
c. 1-12
d. 13-23
Same procedure followed for each group:
1. Make reaction volume following calculations from spreadsheet - mix by tapping tubes, spin down.
2. Incubated in hot water bath at 37C for about 1 hour
3. Add 5ul of Dnase inactivation reagent - use 0.1 volumes
4. Inactivate at room temp for about 2 min- make sure to mix (tap) tubes periodically during this time
5. Centrifuge at 10,000g for 1.5min - used 4C centrifuge
6. Use pipette to extract supernatant from tubes and transfer to a clean 0.5ml tube.
---Tubes labeled "# G pRNA"
7. Stored in -80C.

6/7/12

Today: 1. RNA extraction of all samples except subset from 5/12/12. 2. Spec extracted RNA
Procedure:
Extraction in two batches: a. 1-24 b.25-44,0,X
RNA samples stored in -80C. Box labeled "Bradley -80C Tri-R"
Spec data: Spec data

Next time: Setup for cDNA.

6/1/12

Today: Transfer tissue to tri-reagent. Completed all gill samples except for those already done during subset test.
Procedure:
Homogenized samples in groups of 10, 10, 10 and 12. Total of 42 samples today. 4 samples were previously done for subset (6G, 20G, 29G, 35G)
Samples stored in -80C.
Next time: Start RNA extraction of samples. Max 24 at a time.

5/29/12

Today: Re-make 1.3% agarose gel. Run samples on gel.

Gel made 5/23/12 had wells that had bottom pulled out by comb. Need to remake gel.
Procedure:
Made gel with same procedure from 5/23/12
Used 105mL TAE buffer with 1.4g agarose.
Modification in procedure- took out the comb very slowly while submerged in buffer in electrophoresis box. Helps slide out better so bottom of well does not get pulled out.

Run gel:
Fill electrophoresis box with TAE buffer, with just enough buffer to thinly cover over entire gel.
Run at 100V for 3 min. then to speed up process ran at 115V for rest of the time. Took about 25 minutes total.
Photo of gel. Lane assignment of gel here:
20120530__02.JPG
Note that all primers worked except for crim (lane 17). For negative control, we see primer dimers for many of them.
Picture of gel saved to Bradley sites folder.
Gel disposed in trash.

Next time: Now confident that primers work. Will start RNA extraction for all samples.

5/23/12

Today: 1. Use designed primers to PCR cDNA from 5/11/12. 2. Pour 1.3% agarose gel
Procedure:
PCR
Note: make sure to use PCR specific tubes (in drawer below thermal cycler)- have thinner walls for more efficient heat transfer
Set-up:
Primer dilutions:
-Ordered primers are 100mM
-For PCR want 10mM primers
-Dilute by adding 10uL of 100mM primer to 90uL PCR H2O ::: total of 100uL of 10mM primers
-Did this procedure for primer ordered

Master mix prep:
-Want separate master mix for each primer pair. Have 7 primer pairs so need 7 master mixes.
-Master mix: (25uL for one reaction volume) :: make 4 reaction volumes for 3 treatments (samples, cDNA neg. control, PCR neg. control) (vortex)
-Sample mix= 1uL of each sample [4M, 6G, 12M, 20G, 25M, 29G, 35G, 41M]. Total of 8uL. Mixed together.
1. Use PCR well plate (28 samples total)
2. After adding everything to well- centrifuge plate in the sorvall centrifuge (right room), may need to change out centrifuge plate: spin at over 1,000rpm for about 3 minutes
3. Thermal cycler conditions:
4. PCR product stored in -20 in RNA room (left)

Agarose Gel preparation:
1. Because PCR product is fairly small (100-120bp) want a higher resolution gel. Make 1.33% gel.
2. Use large mold so can fit 28 well comb
3. 105mL TAE buffer with 1.4g agarose
4. Weight TAE with agarose before microwave to see lose evaporation
5. Microwave- with swirling every one minute: microwave until completely clear
6. Re-weight flask and add DI water to original weight if needed
7. Let cool to approx. 55C- test by being able to hold flask by bottom with bare hand comfortably for 30sec
8. Once cool, added 10.5uL EtBr [1:10,000 dilution of EtBr at 10mg/mL]- final concentration of EtBr= 1ug/mL --- gently swirl, do not introduce bubbles
9. Pour gel into mold, and let solidify
10. Comb pulled out, wrapped in saran wrap, stored in 4C fridge.

Next time:
Run PCR product on agarose gel.

5/11/12

Today: RNA extraction from sample stored in tri-reagent (5/1/12), spec extracted RNA, and reverse transcription of RNA to cDNA.
Procedure:
RNA extraction: 8 samples [4M, 6G, 12M, 20G, 25M, 29G, 35G, 41M]
1. Extraction
2. Precipitation
3. Wash
4. Solubilization

Spec procedure: (samples stored on ice)
Login on computer: Open "ND-1000" program
In program:
1. select "nucleic acid"
2. program will prompt for "initialize"- put 2uL nanopure water on pedal, close, open, and wipe lever and pedal with kim wipe
-note: make sure RNA-40 constant is selected
3. add 2uL of solvent (RNA pellet solvent is DEPC H2O) to pedal, close lever, hit "blank"
4. lift lever and wipe lever and pedal with kim wipe
5. add 2uL of sample, close lever, label sample on computer, hit "measure"
6. repeat steps 4 and 5 for all samples
7. save data by going to reports: save report --> save to excel file

Spec data: with calculations for amount of RNA for cDNA - Spec data


cDNA procedure:

5/9/12

Re-designed primers because originally done off of wrong sequence data.
New Primers designed: Primer information

5/1/12

Today- Test a subset of samples for compatibility to primers. Today, will transfer frozen tissue into tri-reagent.

Procedure: Randomly selected oysters to use for testing qPCR primers
  1. Put 0.5mL Tri-Reagent in microfuge tubes (1.5mL- fit the homogenizer)
    • these tubes were labeled # of oyster, M/G for mantle or gill tissue
  2. Frozen tissue samples stored on dry ice to keep frozen, while tri-reagent stored on normal ice
  3. Quickly to avoid melting of tissue, cut piece of tissue and place in tri-reagent tube.
  4. Put leftover tissue back in frozen tube and place on dry ice.
  5. Tissue is tri-reagent tube is homogenized using blue plunger
  6. Once homogenized, place tube back on ice
  7. Tools for cutting (forcep and scissors) were cleaned using treatment of 10% bleach, water, ethanol, and flame
  8. Same procedure for all sample
9. Add another 0.5mL to each tri-reagent tube (should be 1mL tri-reagent in each tube)
10. vortex each tube and stored tubes in -80C

Note: Primers created from before were done using the sequence of incorrect species. Olympia oyster consensus sequence is on Dr. Roberts notebook. Need to re-design primers using the sequences from this file.

Plan- Continue with RNA extraction and making cDNA.

4/20/12

Today- mechanical stress and sample tissue

Procedure: randomly selected which oysters got the stress treatment
1. Mechanical stress
2. Sampling

- The rest of oyster shell and body were stored in a plastic bag in the -20C freezer (on the right side "door" shelf") : labeled "Olympia Oyster 4/20/12"

Other notes: transferred oysters from treatment room into lab using roll cart. Was not very smooth and there was noticeable physical movement during transport.

Plan: possibly extract RNA. Also need to get qPCR primers of genes. Get information on oysters.

4/17/12

4:30pm added about 1mL of algae feed to both containers
re-adjusted the aeration device- no air-flow when I first came in.

4/16/12

3:00pm changed water in both containers
Also fed oysters about 2mL of algae feed
Notes:
-water level at about 2.5 inches
-scrubbed both tanks clean before adding water
-tanks looked noticeably dirtier (lots of pseudofeces) since last check on Friday (4/13)
-having some trouble with getting enough flow from aeration stones- will need to monitor daily to make sure there is consistent flow
-make sure to monitor temp inside room- was at 15C

4/13/12

12:30pm added about 1.5mL of algae feed to both containers
Slight adjustment of aeration stones to get same air flow in both containers
No observable differences in oysters

Plan- Keep monitoring oysters. Change water and feed again on Monday (4/16).
Start to prepare/label tissue biopsy tubes for collection- will need separate tubes for gill, mantle, and whole body
Plan to perform centrifuge and biopsy collection on Friday (4/20)

4/9/12

10:30am changed the water in both containers.
Observations:
No apparent deaths of oysters. Moved oysters gently while changing water, and avoided excess movement.
Water level at about 2.5 inches

Will continue monitoring condition of oysters. Not sure if we need to change water again.
Plan to talk with Dr. Roberts about details on tissue sampling and centrifuge treatment.

4/6/12

About 12:30pm added approx. 2mL of algae feed to both containers with disposable pipette.
Adjusted aeration stones to same airflow and centered them closer to oysters.

Plan:
Keep monitoring oysters.
Change the water on Monday (4/9/12).

-Need information on oysters

Info on feed:
http://www.reedmariculture.com/pdf/product_shellfish_diet_1800.pdf

4/4/12

Olympia oysters came in sometime in the morning. 44 oysters split into two groups, separate containers.22 per container.

Came in around 2:00pm and set the timer for photoperiod treatment. Tarps are not completely draped around 12D:12N container, secure on one side. Left one side open to allow adding the food. Will close everything up once added.

Need to ask for information on the oysters (age, etc.)

Plan to run treatment for about one week. Current holding conditions are 12C, aeration stone. Group A- 12 hours light ; 12 hours dark, Group B- 24 hours light.
*For group A- Light from 6am to 6pm

qPCR Primers:

1. Found the mRNA sequence on NCBI
2. Put into primer3plus- parameters= product: 80-130bp; primer: 18-23bp; Tm: 58-62C; CG content: 40-65%; left the rest at default. Check primers for self-pairing, hairpins, and consecutive G/C's
3. Run primers through BLAST to check for specificity

Xenopus laevis insulin-like growth factor 1 receptor (igf1r)
e-value: 2E-121
NCBI Reference Sequence: NM_001088265.1
Primers: product: 115bp
Left: ATGCTTCTGTGAACCCGGAG – 20bp, Tm: 60C
Right: CCAAACGAACCTTGCCCAAG – 20bp, Tm: 60C
external image IGF1R-%20P3P.png

Bos taurus U2 small nuclear RNA auxiliary factor 1-like 4 (U2AF1L4)
e-value: 6.00E-84
NCBI Reference Sequence: NM_001034778.1
Primers: product: 130bp
Left: GCAGACGGATCTCACTGTCA – 20bp, Tm: 60C
Right: GGTTGTCGCACACATTCATC – 20bp, Tm: 60C
external image U2AF1L4-%20P3P.png

Bos taurus protein kinase, cGMP-dependent, type I (PRKG1)
e-value: 0
NCBI Reference Sequence: NM_174436.2
Primers: product: 109bp
Left: CGAGGTTATGCCAAACTGGT – 20bp, Tm: 60C
Right: GGATGATCTCTGGGGCTACA – 20bp, Tm: 60C – but 4 G’s in a row??
external image PRKG1-%20P3P.png

Danio rerio cysteine rich transmembrane BMP regulator 1 (chordin like) (crim1)
e-value: 3.00E-38
NCBI Reference Sequence: NM_212821.1
Primers: product: 130bp
Left: AAAACTGGGATGACGACCAG – 20bp, Tm: 60C
Right: GCGAACTCAAATGGGTTGTT – 20bp, Tm: 60C
external image CRIM1-%20P3P.png
Bos taurus BCL2-associated athanogene 2 (BAG2)
e-value: 6.00E-18
NCBI Reference Sequence: NM_001034264.1
Primers: product: 83bp
Left: TTGCCTCCCATTCCACTTAC – 20bp, Tm: 59.9C
Right: AGCTCGGTGTGCGTAAATCT – 20bp, Tm: 59.9C
external image BAG2-%20P3P.png

Homo sapiens heat shock protein 90kDa alpha (cytosolic), class B member 1 (HSP90AB1)
e-value: 0
NCBI Reference Sequence: NM_007355.2
Primers: product: 114bp
Left: ATGGAAGAGAGCAAGGCAAA – 20bp, Tm: 60C
Right: GCAGCAAGGTGAAGACACAA – 20bp, Tm: 60C
external image HSP90-%20P3P.png

Capstone Notes:
Experimental temp: http://www.nodc.noaa.gov/dsdt/cwtg/npac.html
Photoperiod: http://aa.usno.navy.mil/cgi-bin/aa_rstablew2.pl


9/29/11

Today: 1. Make gel and run PCR product from 9/1/11

Methods:
-Make gel
1. Made approx. 1% agarose gel (75mL TAE buffer w/ 8g agarose)- use slightly larger flask (500mL)
2. Microwave ~3min with swirling every 1min: check for agarose to be completely soluble
3. Added 6uL EtBr and swirled
4. Wait to cool down a bit and pour into mold
Notes:
-Run gel
1. Loaded samples (from left to right)
    1. 10kb ladder- loaded 5uL (http://genefish.fish.washington.edu/~srlab/Steven/Commercial%20Protocols:Manuals/HyperLadderI.jpg)
    2. 6E PCR - 10uL
    3. 8E PCR - 10uL
    4. 1L PCR - 10uL
    5. 4L PCR - 10uL
    6. -PCR control from 9/1/11 - 10uL
    7. -PCR control from 9/1/11 - 10uL
    8. -PCR control from 9/1/11 - 10uL

2. Add 1x TAE buffer to fill the entire electrophoresis box (buffer should be covering gel)
3. Hook up electricity cables- DNA should run towards +charge (voltage in power box to 107V)
4. Check for bubbles on + end to make sure it is working
5. Run time dependent of purpose of gel (check gel vs. size identification)

Results:
external image 20110929.JPG
See expected bands for all PCR products and no bands for neg. controls

Next time: PCR all samples of cDNA from (8/31/11) to check for differences between early and late groups. Expect to see difference in band intensity.

9/1/2011

Today: Select a few cDNA samples to PCR. Test to see if assay works.

Methods: Primer info at 6/24/11
cDNA from 8/31/11. Used samples 6E, 8E, 1L, and 4L. Also made 3 neg. controls with H2O.
Reaction volume: 25ul (2X Apex red= 12.5uL, F primer= 0.5uL, R primer= 0.5uL, template= 1.0uL, H2O= 10.5uL)
1. Master Mix (20uL per tube; made 7x for 7 tubes ):
2. Samples diluted by adding 1uL cDNA template and 4uL H2O for 5uL total
3. Template (5uL) added after master mix
4. Thermocyling parameters (folder BC :: file APEXBC)
5. Store in 4C fridge

Note: make sure to use PCR tubes (at drawer under the thermocycler- tubes have thinner walls, heat transfers more quickly)

Next time: make agarose gel and run PCR product on gel

8/31/2011

Today: Make cDNA from 8/5/11 and 8/11/11 RNA extractions

Methods:
Reverse transcription
-Assume less than 1ug RNA from extraction
1. Want 25 reaction volumes (10 early, 14 late, and 1 - control). Made 26 reaction volume master mix.
2. 17.75uL RNA extract with 0.5uL oligo dT primer. H2O used for - control.
3. Break secondary structure and anneal primer: thermocycler 70C for 5min
4. Master Mix (for 26 tubes) [6.75uL per tube]
5. Primer extension: thermocycler 42C for 1hr
6. Heat inactivate: thermocycler 95C for 3min
7. Store -20C

Next time: Decide how to proceed with cDNA. Could compare telomerase expression in early and late senescence.

8/29/2011

Today: Spec the extracted samples from 8/5/11 and 8/11/11 to check for nucleics

Methods: Use nanodrop
Results:
external image 2011_8_29_Spec01.jpg

Next time: Start making cDNA

8/11/2011

Today: RNA extraction of 8/2/2011 sample stored in Tri-Reagent (2nd half)

Methods: Extracted 3-14 late (12 samples total): Check 8/2/2011 for labeling
1. Extraction
2. Precipitation
3. Wash
4. Solubilization
Note:
Spilled a bit of sample 9L during extraction step

Next time: spec samples

8/5/2011

Today: RNA extraction of 8/2/2011 sample stored in Tri-Reagent

Methods: Extracted 1-10 early and 1-2 late (12 samples total): Check 8/2/2011 for labeling
1. Extraction
2. Precipitation
3. Wash
4. Solubilization

Next time: Extract other 12 samples from sample set

8/2/2011

Today: 1. Prepare samples for extraction by putting tissue in Tri-Reagent
2. Results from re-spec of 7/12/2011

Methods:
Sample information and labeling information:
https://spreadsheets.google.com/spreadsheet/ccc?key=0ArvO3xgNTmCidFc4TkdYcWQ3dGxYcGs3Z3lpRVJkOWc&hl=en_US#gid=0
1. add 500uL tri-r to tube
2. add small piece of tissue (1/4 size of pinky nail)
3. homogenize in tube
4. add 500uL tri-r to tube
5. stored in -80C
Notes:

Next time: Begin RNA extraction of samples

7/12/2011

Today: 1. RNA extraction of 44,46,47,62,63 and 64 samples of senescent sockeye salmon males
from: https://spreadsheets.google.com/spreadsheet/ccc?key=0AtV_gF766XZAdDNmV09UX1M0UlFUUkloQ3gtWlByTHc#gid=0
2. Spec product of RNA extraction from today (7/12/11) and 7/5/11

Methods:
-RNA extraction
Sample were homogenized and stored in Tri-Reagent at an earlier date
Labels:
RNA 11 = 44 ; RNA 12 = 46 ; RNA 13 = 47 ; RNA 14 = 62 ; RNA 15 = 63 ; RNA 16 = 64
1. Extraction
2. Precipitation
3. Wash
4. Solubilization
-Spec (Nanodrop)
1. follow instructions in program
2. clean with kimwipe
3. add 2uL sample- tap/mix sample before adding
-- Had some samples not fully dissolved leading to inconsistent spec readings. Will slightly heat samples next time to make sure they are dissolved before do spec.
Notes:

Next time: Redo do spec and look for consistent readings

7/5/2011

Today: RNA extraction of 9,10,11,12, 13 and 14 samples of pre-senescent sockeye salmon males
from: https://spreadsheets.google.com/spreadsheet/ccc?key=0AtV_gF766XZAdDNmV09UX1M0UlFUUkloQ3gtWlByTHc#gid=0

Methods:
Sample were homogenized and stored in Tri-Reagent at an earlier date
Labels:
RNA 1 = 9 ; RNA 2 = 10 ; RNA 3 = 11 ; RNA 4 = 12 ; RNA 5 = 13 ; RNA 6 = 14
1. Extraction
2. Precipitation
3. Wash
4. Solubilization

Next time:
Could extract RNA from senescent males

7/1/2011

Today: Run PCR product on gel

Methods:
Samples loaded in wells:
  1. 10kb ladder- loaded 5uL (http://genefish.fish.washington.edu/~srlab/Steven/Commercial%20Protocols:Manuals/HyperLadderI.jpg)
  2. 56A cDNA from 6/17/11 - 10uL
  3. 58A cDNA from 6/17/11 - 10uL
  4. -cDNA control from 6/17/11 - 10uL
  5. -PCR control from 6/24/11 - 10uL
  6. -PCR control from 6/24/11 - 10uL
  7. blank
  8. blank
1. slide gel into mold and pour 1x TAE buffer to fully cover gel
2. load wells with samples (don't need to go far into well, loading dye helps sample fall down into well)
3. quickly attach current to mold (black at wells and red at bottom: "runs to red")
4. voltage set at 100V and run for 50min
5. UV machine to view bands

Results:
photo.JPG
left to right: 10kb ladder, 56A, 58A, -cDNA, -PCR, -PCR

Gel supports conclusion that PCR was successful. All negative controls were as expected.
Notes:
1. make sure no bubbles when looking at gel
2. can add EtBr to buffer to increase clarity of bands
3. reasons bands don't show up: a. did procedure wrong b. no mRNA expressed

Next time: RNA extraction of more 2009 senescent male brain tissue samples
Want to determine what kind of gene expression information be can get out of these tissue samples

6/24/2011

Today: 1. PCR 2. Make gel
Full technique: http://genefish.wikispaces.com/protocols#Protocols-Conventional%20PCR%20%282x%20Apex%20Red%29

Methods:
Primer Info (from Caroline):
Forward Primer: AAAGGCTTTGTGATGGCACT
20bp tm 59.7 GC 45%
Reverse Primer: CGTTTTCTTCCCAAACTGGA
20bp tm 60.1 GC 45%
Amplicon size 150bp
Primer designing method: http://www.evernote.com/pub/cgstorer/carolinesnotebook#b=c5e05cfb-8b7e-42dd-abd1-490de048dfa5&n=79961e44-55c4-444b-a486-6297defa405b
--PCR
Reaction volume: 25ul (2X Apex red= 12.5uL, F primer= 0.5uL, R primer= 0.5uL, template= 1.0uL, H2O= 10.5uL)
1. Master Mix (20uL per tube; made 7x for 5 tubes ):
2. Samples diluted by adding 1uL cDNA template and 4uL H2O for 5uL total
3. Template (5uL) added after master mix
4. Thermocyling parameters (folder BC :: file APEXBC)
5. Store in 4C fridge
--Making gel
1. 1% agarose gel (1g agarose per 100mL 1x TAE buffer): used small mold- 0.75g agarose and 75mL buffer
2. put into flask but do not mix, microwave until it starts to boil and stop- look for all of agarose to be dissolved.. keep microwaving if not
3. take out and swirl, let sit until lukewarm (able to hold flask without mit and little steam coming out of flask)
4. add 7.5uL EtBr- swirl to mix [10uL EtBr per 100mL buffer]
4. pour into mold (make sure there are no bubbles- get them out with pipette tip) and add comb- used 8 well comb
5. let cool until solid
6. stored in 4C fridge

Notes:
1. Pipette small volumes directed into the liquid, not above, to help precision and accuracy
2. Careful with agarose- do not contaminate, expensive
3. Master mix into general waste

Next time: Run PCR product on gel

6/17/2011

Today: 1. Reverse transcription- RNA => cDNA 2. Determine primers and reagents for PCR next time
Full technique: http://genefish.wikispaces.com/protocols#Protocols-Reverse%20Transcription%20%28Promega%20M-MLV%20Protocol%29
Manufacturer protocol: http://genefish.fish.washington.edu/%7Esrlab/Steven/Commercial%20Protocols:Manuals/Promega%20-%20MMLV%20RT.pdf

Methods:
Reverse transcription
-Assume less than 1ug RNA from extraction
1. Made 3 reaction volumes (56A, 58A and negative control [w/ RNase free H2O])
2. 17.75uL RNA extract or H20 with 0.5uL oligo dT primer
3. Break secondary structure and anneal primer: thermocycler 70C for 5min
4. Master Mix (for 3 tubes) [6.75uL per tube]
5. Primer extension: thermocycler 42C for 1hr
6. Heat inactivate: thermocycler 95C for 3min
7. Store -20C
Notes:
Reverse Transcriptase expensive- keep in freezer and don't contaminate

Gene identification: GeneBank on NCBI
- decided to look at telomerase gene of O. nerka
-forward and backwards primers bought from IDT (20-21bp, annealing temp 53-55C)
PCR
Use 2X Red Apex master mix: contains Taq polymerase, dNTPs, buffer, dye
PCR H2O = RNase-free H2O
Master mix- make 2 tubes extra for negative PCR control.

Next time: Complete PCR of cDNA

6/13/2011

Today: Learning lab techniques- RNA extraction => Do this at RNA extraction bench/ station
Full technique: http://genefish.wikispaces.com/protocols#Protocols-RNA%20Extraction
Manufacturer protocol: http://www.mrcgene.com/tri.htm

Methods:
Two samples- replicated extraction (labeled 56A, 56B and 58A, 58B)
Notes:
1. Homogenize
2. Extraction [0.2mL chloroform/1mL Tri]
3. Precipitation [0.5mL isoprop/ 1mL Tri]
4. Wash [1mL 75% ethanol in DEPC/ 1mL Tri]
5. Solubilization

General lab info:
Shared room:
Pipette use- hold grey tab and spin to change volume

Sample information:
O. nerka brain tissue- females in senescence: used sample # 56 and 58
Sampling data set: https://spreadsheets.google.com/spreadsheet/ccc?key=0AtV_gF766XZAdDNmV09UX1M0UlFUUkloQ3gtWlByTHc#gid=0

Next time: See if extraction was successful. See how much RNA was extracted.IGF1R