March 24, 2011
Ceramide sequencing: cloning
SR cloned 4 PCR products for acid ceramidase and 4 for ceramide glucosyltransferase. I did the plasma minipreps today following the same protocol outlined March 8, 2011 except the spinning for 13,000xg was actually done at 13,000 rpm. The DNA and primer plates for sequencing were updated with the new plasmids and primers.
March 18, 2011
Ceramide sequencing: cloning
Pooled equal volumes of control oyster gill tissue at the 3 hour time point for the PCR. Each PCR reaction had 12.5 uL Apex, 8.5 uL water, 0.5 uL each primer, and 3 uL cDNA. Primers used were ceramide glucosyltransferase and acid ceramidase (also NTCs). Ran on program GENPCR (Emma directory).
Made 1.2% agarose gel (50 uL 1xTAE, 0.6 g agar, 5 uL EtBr). Loaded 5 uL of Bioline's Hyperladder and 10 uL PCR product and ran 100 V for ~30 min.
Observed band sizes corresponded to expected sizes: 1080 bp for ceramide glucosyltransferase and 1165 bp for acid ceramidase. Cut out bands and stored at -20 C in cDNA III box.
March 9, 2011
Ceramide sequencing: cloning
Checked the colonies from the re-cloning started on 3.7.2011 and there were not many so let them grow until today. Still very few colonies. Only one dark blue colony grew on the plates streaked with the Bioline cells. Only dark blue colonies on the TOPO cell plates. Fail :(
Ceramide: tissue distribution
Below are the graphs of the tissue distribution of gene expression for the genes identified in the ceramide pathway. qPCRs were done on 3.8.11 (ASMase), 12.14.10 (Sptlc1), and 3.1.11 (3KDSR, CMglctrans, ACMase). All data were analyzed in PCR miner and are averages across duplicate Cts. Expression values are normalized to EF1a (qPCR 11.30.10).
March 8, 2011
Ceramide sequencing: cloning
Qiagen miniprep for Sptlc1 and 3-KDSR. Clones grew well in LB+kan overnight - all tubes were cloudy so did minipreps of all 11 samples.
Put 1.5 mL of LB mixture in an eppie tube, spun at max speed for 2 minutes, decanted supernatant, added 1.5 mL more and repeated.
Added 250 uL P1 buffer to pellet and vortexed to resuspend.
Added 250 uL P2 and inverted 4 times.
Added 350 uL N3 and inverted 4 times immediately. Spun at 13,000xg (should have been rpm) for 10 minutes.
Put supernatant in Qiagen column and spun at 13,000xg for 1 minute.
Added 750 uL of PE buffer to column, spun at max speed 1 minute. Removed flow-through and spun again at max speed. Put column in new eppie tube.
Added 30 uL EB buffer to column, incubated at RT 1 minute, spun down at max speed 1 min.
Stored eluted cDNA at -20C.
Ceramide: qPCR
qPCR for tissue distribution of acid sphingomyelinase (I don't believe the results from the previous qPCR since ASMase is expressed in gill tissue as evidenced by the PCRs done for vibrio exposure).
Results: NTCs are clean. Distribution was the same as seen previously: high expression in the digestive gland and very low in other tissues. See 3.9.2011 for graph.
March 7, 2011
Ceramide sequencing: cloning
All colonies grew on gridded plates over the weekend. Two of the no-template controls in the PCR evaporated (for acid ceramidase and 3-KDSR).
Made a 1.2% agarose gel (1.2 g agar, 100 mL 1xTAE, 10 uL EtBr) and loaded 10 uL of PCR product into wells. Ran at 100V for ~40 min.
The two primer pairs with colonies that amplified, Sptlc1 and 3-KDSR, had only one product and it is of correct size for both primers (see 3.3.2011). None of the light blue colonies amplified the correct product for any of the primer pairs. The two NTCs were clean. Filled sterilized glass tubes with sponge stoppers with 5 mL of 1XLB + 50 mg/mL Kanamyacin (made by MG 12.22.09). For each of the restreaked white colonies (Sptlc n=3; 3-KDSR n=8), touched a sterilized toothpick to the colony and then dropped it in a tube. Incubated the tubes at 37C, 250 rmp overnight.
Recloning of ACMase and Cm glucosyltransferase. Same protocol as 3.3.2011 (see for details) using the purified PCR bands from that day as template (verified presence of DNA in PCR product). Instead of using just One Shot TOP 10 competent cells (TOPO), doing a comparison with Bioline's CH3-Blue Chemically Competent cells.
March 4, 2011
Ceramide sequencing: cloning
7:30 am : only a few colonies have grown, mostly on the plates spread with 200 uL. Will let grow until this afternoon.
1: 30 pm : more colonies and larger, but still very few white colonies.
Gridded LB+kan plates to restreak picked colonies. Picked colonies (details below) with sterile plastic wand and put wand tip in 50 uL of aliquoted master mix (25 uL Apex, 23 uL water, 1 uL each primer). PCR CLNY program on SBR directory: 94C 8 min; 40x 94C, 45s, 50C 1 min, 72C 1 min 30s; 72C, 10 min. Left restreaked plates on benchtop to incubate over the weekend.
Ceramide glucosyltransferase: 3 light blue colonies, 1 dark blue
Sptlc1: 3 white colonies, 5 light blue, 1 dark blue
acid ceramidase: 1 light blue, 1 dark blue
3-KDSR: 7 white colonies, 1 dark blue
March 3, 2011
Ceramide sequencing: cloning
Made LB for plates: 100 mL 5x LB (lab stock) + 400 mL nanopure water + 7.5 g Bacto Agar in a large flask. Swirled to mix and covered with foil. Autoclaved 20 min at 121C (sterilization only). Let cool on bench until cool enough to touch for ~30s. Added 500 uL of Kanamyacin (50 mg/uL), swirled to mix and filled plates. Covered plates and let cool on bench until set. Stored at 4C in plastic sleeve.
PCR for sequencing. Made two pools of cDNA, control and vibrio exposed, from 3 hour time point (gill tissue). 3 uL of each sample (n=8) went into each pool. Made master mixes for primers of full-length gene product for acid sphingomyelinase, 3-ketodihydrosphingosine, acid ceramidase, serine palmitoyltransferase 1, and ceramide glucosyltransferase. Master mixes included (per reaction) 12.5 uL Apex mix, 8.5 uL water, 0.5 uL of each primer, and 3 uL of cDNA. Thermocycler conditions (GENPCR in Emma's directory) are 1. 95C, 10 min, 2. 95C, 30s, 3. 55C, 30s, 4. 72C, 30s (back to 2 x39), 5. 72C, 10 min.
Ran 10 uL of PCR products on 2% agarose gel (100 mL 1xTAE, 2 g agarose, 10 uL EtBr) at 100 V for ~45 minutes. The vibrio exposure and negative control samples amplified with ceramide glucosyltransferase primers evaporated a bit and were reconstituted with 10 uL of nanopure water and loaded on gel.
Acid sphingomyelinase primers did not amplify a product. All other product sizes match up well with expected sizes.
Cut out bands for each of the amplified control PCRs. Spun them down in millipore ultrafree tubes at 5,000xg for 10 minutes (NB: do not use 2% gels in the future because they do not easily go through the funnel of the tubes.) In a strip tube put 2 uL of PCR product, 0.5 uL of salt soln (TOPO kit), and 0.5 uL vector (TOPO). Incubated at 22C for 10 min on thermocycler and then put on ice. Thawed competent cells on ice while incubation at 22C. Added 2 uL of PCR mix to competent cells, swirling while adding. Put on ice for 10 minutes, then heat shocked at 42C for 30s, then on ice for 2 min. Added 250 uL of room temp SOC in hood, rolling tubes on side to coat. Taped tubes on side in shaker at 37C, 225 rpm for 1 hour.
Put 8 LB+kan plates at room temp. Spread plates with 80 uL of XGAL (20 mg/mL) and dried in oven at 37C. Spread 2 plates for each gene - one with 50 uL of transformed cells and one with 200 uL. Let dry with lids cracked at 37C and then incubated overnight upside down.
March 1, 2011
Ceramide qPCR
qPCR of tissue distribution in mantle, muscle, digestive gland, and gill (samples extracted 10.27.10) using primers for acid ceramidase, ceramide glucosyltransferase, and 2-ketodihydrosphingosine reductase in duplicate. Also qPCR of control and vibrio-exposed 3 hour time point gill samples using acid sphingomyelinase primers (duplicate). Thermalcycler protocol was 3StepAmp+Melt_SJW.
Results: Single melt curves for each gene and NTCs were clean. Data were analyzed in qPCR miner. Gene efficiencies were good except ceramide glucosyltransferase had an average 69.6% efficiency. Others were 3KDSR 86.1%, ceramidase 90.1%, and sphingomyelinase 89.9%. For sample E8 (SMase) one of the replicates was wonky and so the expression value was thrown off and the sample was not included in the analyses. There is no significant difference in expression for acid sphingomyelinase between control and vibrio-exposed oyster gill at 3 hours post exposure. The outliers for both control (C5) and exposed (E6) had consistent Ct values across both PCR replicates and are most likely true expression values.
Environmental monitoring
Retrieved PSDs from Discovery Bay at 9 pm, tide height = 0'6". Samplers were found easily by following rope to which the cinder block was attached. Both samplers were still free from sediment and submerged. After retrieval, PSDs were stored at -20C.
February 16, 2011
Environmental monitoring
Deployed 2 PSDs at site described below at 8:40 pm, low tide height -1'1".
February 15, 2011
Environmental monitoring
Went to Discovery Park to find a good spot for PSD deployment. The treatment plant touches both North and South beaches. North Beach has calmer water and seems to be less trafficked by park users. There is a small beach before the main beach that looks to be a good place for deployment. The cinder block with 2 attached POCIS will be tied to a rope that is anchored at the shore line near some rocks (see schematic below). PSDs have been mounted in vegetable steamers for deployment.
Map of Discovery Park and deployment site.
Beach deployment plan.
Northeast view of Shilshole from site.
February 14, 2011
Environmental monitoring
Got 2 PSDs (POCIS) from Irv Schultz. Brought back to Seattle and stored at -20C.
Went to assess Fort Lewis site yesterday. The site is on the military base and there are a few signs that say it is closed after dark as well as a number of gates that could potentially be closed. Irv says that the gates have not been closed when he is there at night, but I have decided it's risky and on the wrong side of legal so I am choosing another site.
The West Point Treatment Plant is the largest wastewater treatment plant in King County (circled in pink below).
The outfall from the plant is ~3000 ft offshore and 300 ft deep.
The plant is located in Discovery Park. I'm going out this afternoon to look around and see how accessible the shoreline near the plant is for deploying PSDs. There are low tides Tues, Wed, and Thurs nights this week.
February 10, 2011
Vibrio exposure/ceramide: qPCR
qPCR using primers acid ceramidase and 3-KDSR. For ACMase, PCR'd all 3 hour gill samples, control and exposed, in duplicate. For both primer pairs, PCR'd control and exposed from 1 hr time point (n=4).
Results:
Acid ceramidase, all samples - significantly different expression between control and exposed (p=0.045)
Acid ceramidase and 3-ketodihydrosphingosine reductase, 1 hour timepoint n=4 for exposed and control - no significant differences in expression at this time point.
February 8, 2011
Vibrio exposure/ceramide: qPCR
qPCR using new primers, 3-ketodihydrosphingosine reductase, ceramide glucosyltransferase, and acid ceramidase on gill tissues from vibrio exposed and control oysters (n=4 for each treatment with each primer pair). 1 uL of cDNA and 24 uL of master mix were used for each reaction.
Results: All primers amplified product and had one melt curve. All NTCs were clean. A number of the samples for ceramide glucosyltransferase came up very late and as a result 1 control and 2 exposed were set to 0 expression level for the analysis. The other Cts were >42 and may not be trustworthy, although they were analyzed in Miner. If these primers are to be continued they need to be optimized.
None of the differences between treatments were significant (n=4 for control and vibrio exposed) although there is a trend for upregulation of these genes in vibrio exposure, except for ceramide glucosyltransferase.
February 7, 2011
Vibrio exposure: qPCR
Results from qPCR 2.3.2011: All samples amplified and NTCs were clean. Analyzed data in qPCR miner and calculated expression values for each sample using equation 1=1/(1+AER)^Ct. Calculated normalized expression for Sptlc1. Box plot of expression values below. Blue boxes are for 1 hour time points and green boxes are for 3 hour. There is no difference between treatments at any time point, but there is a trend for increased expression of Sptlc1 in the exposed group at 3 hours.
Ceramide: new primers
Received primers described 2.2.11. Made new TE buffer pH 8.5 as described 1.11.10. Reconstituted all primers to 100 uM.
Vibrio exposure/Ceramide: qPCR
qPCR using EF1a and Sptlc1 primers on gill samples from vibrio exposure experiment, 3 hour time point. All sampled qPCR'd in duplicate.
Results: calculated expression values as described above. Normalized expression of Sptlc1 is barely insignificant for increased expression in vibrio exposed versus control.
February 3, 2011
Vibrio exposure: qPCR
Diluted all cDNA 4x (72 uL water + 24 uL cDNA). Using EF1a (SR ID 309) and Sptlc1 primers for samples C1-4 1 hour, E1-4 1 hour, C1-4 3 hours, and E1-4 3 hours.
February 2, 2011
Vibrio exposure: reverse transcription
qPCR from 1.31.2011 showed possible (although very little) gDNA contamination in samples: Gill C2 1 hour, gill E2 1h, gill E2 3h, muscle C2, mantle C1.
Reverse transcribed all gill samples, control and exposed, from 1 and 3 hr time points (n=32). To 14 uL of DNased RNA (~1 ug) added 0.5 uL oligo dT primers and 3.75 uL of water. Incubated at 70C for 5 minutes. Put rxn on ice for a few minutes then added to each well: 5 uL MMLV RT buffer, 1.25 uL dNTPs, 0.5 uL MMLV reverse transcriptase. Incubated at 42C for 1 hour, heat deactivation 95C for 3 minutes. Stored cDNA in Emma's cDNA Box III.
Vibrio exposure: qPCR
Made pooled samples of control and exposed gill cDNA (across 1 and 3 hour time points, n=16 in each pool). 1 uL from each sample was put in each pool. qPCR was done using EF1 and Sptlc1 primers on the pooled cDNA at full concentration and diluted 2x, 4x, and 10x from control and exposed samples for each primer pair.
Results: All dilution factors amplified for both genes, although EF1a had much lower Ct than Sptlc1 (see table below). A 4x dilution will probably work well for these samples and the genes we are testing. PCR miner successfully analyzed all the data.
Environmental monitoring
Talked to Irv Schultz about pilot study to test PSDs in salt water (again) and possibly generate preliminary data for a grant. The plan is to pick 1 or 2 sites, between which 3 PSDs will be divided. The PSDs will be put out for ~3 weeks and upon retrieval, we will also trap a few crabs to look at bioaccumulation in the hepatopancreas. The possible sites are:
1. Fort Lewis: sewage discharge is near Solo Point, Take exit for base and go west to solo point road and enter the fort, the road will dead end at the park. About 1/4 mile south is a pipe from the treatment plant that discharges waste ~100 ft below the surface offshore. Need a pretty low tide to deploy PSDs. The first negative tide for February is the 15th (see tides).
2. Bremerton naval base: can approach outfall from the Bremerton ferry dock.
3. a marina
4. Myrtle Edwards Park (my suggestion) is near a combined sewer overflow.
Ceramide: in silico search for full-length sequences
Continued from 1.31.2011
I took detailed notes on everything that I did but the wiki didn't save them. I will paraphrase the work and my findings below. The form of the methods used was similar to those described in detail on 1.31.2011.
Neutral sphingomyelinase
Assembled novel 454 DB hits with previously found ESTs. 2 contigs were made, one with 40 reads and one with 6. The one with 40 blasts to NSMase, the one with 6 does not have a match in SwissProt. The new contig is still missing coding sequence on the 5' end.
3-ketodihydrosphingosine reductase
Through adding 454 sequence data, the entire coding sequence was assembled for this gene.
Ceramide synthase (Lass6)
Through assembly of C. gigas EST with 454 sequences, found start codon (entire 5' end) but still missing ~18 amino acid residues from the 3' end of the sequence.
Designed primers for sequencing and qPCR of 3-ketodihydrosphingosine reductase (SR ID for sequencing primers: 1188 & 1189; for qPCR: 1186 & 1187), ceramide glucosyltransferase (sequencing SR ID: 1178 & 1179, qPCR: 1180 & 1181), and acid ceramidase (sequencing: 1182 & 1183, qPCR: 1184 & 1185).
January 31, 2011
Vibrio exposure
qPCR with 18s primers of DNAsed RNA from SJW for adult C. gigas 1 and 3 hr post-vibrio exposure.
Ceramide: in silico search for full-length sequences
Ceramide glucosyltransferase
Created a custom database in geneious with the 6-day-old larval transcriptome data from 454 sequencing (now called "454 DB"). Did megablast of longest EST from ceramide glucosyltransferase (the other ESTs lay within the long one). Got 6 454 ESTs that matched to original, assembled all and extracted consensus sequence. blastx of consensus EST against swissprot database Xenopus tropicalis ceramide glucosyltransferase (Q5BL38.1), e = 2e-53 and protein coding starts before bp 98 on C. gigas EST query. Through protein alignment, found start codon at bp 35 of contig, so translated from bp 35 to get final protein coding sequence for C. gigas. blastp returns top hit of ceramide glucosyltransferase (gene structure).
Acid ceramidase
blasted (megablast) EST AM856720.1 against 454 DB and returned a lot of ESTs. The first 5 top returns did not add significantly to the original ESTs found 1.29.2011. Did megablast of contig of original 4 ESTs found on GenBank against 454 DB but the top 5 hits did not extend the sequence at all.
blastx of original contig (contig 1597 in geneious) on NCBI. Top hit was rat acid ceramidase (Q6P7S1.1) and protein coding in the alignment began at bp 69. Extending to start codon at bp 15 looks like it encompasses the entire protein sequence.
Neutral sphingomyelinase
454DB megablast of HS230283.1 returned a lot of hits. Assembly with the top 5 extends the sequence a little in the 3' direction. Assembly with the top 10 extends the original sequence in both directions. Extract the consensus and blastx - top hit is C. elegans neutral sphingomyelinase (O45870.2, e=5e-59) with protein coding in the alignment starting at bp 10. there is no start codon at or before 10 bp and alignment of the amino acid sequences shows that there may be ~80 aa residues (>200 bp) missing from the C. gigas sequence on the 5' end.
Assembled all the megablast return (n=22 + original EST) and generated consensus sequence. Did megablast of consensus
January 29, 2011
Ceramide: in silico search for full-length sequences
Continuation of work from 1/28/2011 to find available full-length cDNA for the constituents of the ceramide pathway.
Ceramide glucosyltransferase/glucosylceramide synthase: makes glucosylceramide from ceramide
Homologene number 37763. H. sapiens and C. elegans (cgt-1) align with 48% identity - pretty good.
blastn of C. elegans mRNA (NM_074570.3) against C. gigas nucleotides and ESTs yielded no results.
tblastn of C. elegans protein ( NP_506971.2) against C. gigas ESTs returned top hit HS163638.1 (mixed adult tissues). E value was 5e-50 and EST covers only part of protein sequence. Protein coding in alignment begins at bp 47 of C. gigas EST, so translated the sequence and did pblast. top hit is xenopus ceramide glucosyltransferase (Q5BL38.1), e=3e-58, with very good coverage.
blastn of C. gigas EST HS163638.1 against other C. gigas ESTs to see if mRNA can be extended at all. Returned 2 more ESTs - FP003616.1 and FP009071.1. Neither EST adds any length to the original.
Ceramide kinase: makes ceramide 1-P from ceramide
Homologene 11247
Aligned protein sequences: C. elegans shows poor identity (27%) with H. sapiens; D. melanogaster has better identity (32%) and D. rerio and H. sapiens share 46% identity.
blastn of D. rerio mRNA (NM_001105586.1) against C. gigas nucleotides and ESTs yields no results.
tblastn of D. rerio protein (NP_001099056.1) against C. gigas ESTs brings back HS203383.1 (e=4e-15) but coverage is poor. tblastn with D. melanogaster protein sequence similarly returns FQ661838.1 (e=3e-24), but coverage is poor. These 2 ESTs do not form a contig.
Glucosylceramidase(/cerebrosidase?)
homologene 10859
Alignment of C. elegans and H. sapiens proteins shows ~37% identity between the two. D. melanogaster and H. sapiens share 43% identity.
blastn of D. melanogaster mRNA (NM_176041.1) against C. gigas nucleotide and ESTs returns no results.
tblastn of D. melanogaster protein (NP_788055.2) against C. gigas ESTs returns CU996255.1, but it only covers the last 200 bp of the protein sequence (e=7e-69). not going to pursue this one further
Acid ceramidase: makes ceramide from sphingosine
homologene 10504
H. sapiens and C. elegans protein sequences share 38% identity. H. sapiens and D. rerio share 59%.
blastn of C. elegans mRNA (NM_060772.7) against C. gigas nucleotide and ESTs returns no results.
tblastn of C. elegans protein (NP_493173.1) against C. gigas ESTs returns top hit AM854720.1 (e=2e-72) with excellent coverage of the protein sequence.
Protein coding on the alignment begins at bp 4 of the C. gigas EST. Translated sequence and did blastp. Returned acid ceramidase from Pan troglodytes (A5A6P2.1), e = 1e-89.
blastn of C. gigas EST AM854720.1 against other C. gigas ESTs returned 5 EST hits: HS193380.1 (e=0), FP005089.1 (4e-175), HS193379.1 (1e-135), HS210738.1 (1e-119), CU682703.1 (7e-73). The first 3 hits all assemble to add more length to the original EST.
Extracted the consensus sequence and did blastx. Top hit is human acid ceramidase (e=4e-110) with good coverage. Translated sequence beginning at bp 75 and did blastp. Top hit was H. sapiens acid ceramidase (Q13510.5, e = 1e-100).
blastn of consensus EST against other C. gigas ESTs. Along with previous returns for blasts of this sequence, 2 novel ESTs were retrieved: CU682444.1 (e=0) and AM854478.1 (2e-46). Assembled with contig but AM854478.1 did not assemble and CU682444.1 only added a few bp.
Neutral sphingomyelinase
homologene 2652
H. sapiens and A. gambiae share 40% identity.
blastn of A. gambiae mRNA (XM_310670.4) against C. gigas nucleotide and ESTs yielded no results.
tblastn of A. gambiae protein (XP_310670.4) against C. gigas ESTs returned mixed adult tissue HS222394.1 (e=8e-74) with patchy coverage. Second hit HS230740.1 has slightly more complete coverage of the protein and an equally strong e-value (2e-70), so will use that sequence for further searches. Coding in the protein alignment begins at bp 13. Translated sequence and did blastp. This sequence corresponds to factor-associated with neutral sphingomyelinase activation, so start over with actual enzyme.
homologene 31129
H. sapiens and C. elegans proteins align with 43% identity.
blastn of C. elegans mRNA (NM_060768.3) against C. gigas nucleotides and ESTs
tlbastn of C. elegans protein (NP_493169.2) returned a top hit HS230283.1 (e=2e-46) with OK coverage. Protein coding in the alignment begins at bp 13, so translated mRNA and did blastp of protein sequence. Top hit is C. elegans putative NSMase (O45870.2, e=2e-46)
blastn of C. gigas EST HS230283.1 against other gigas ESTs returns 4 ESTs: AM864642.1 (e=7e-142), AM863597.1 (1e-135), HS230284.1 (1e-79), FP002080.1 (7e-8). All 4 ESTs added significant length to original.
Extracted consensus sequence and did blastx. Top hit is D. melanogaster putative NSMase (Q9VZS6.2, e=3e-62). The protein corresponds to the first ~900 bp of the C. gigas contig. Translated bp 34-879 of contig (coding sequence that corresponds to Dmel protein). blastp of this translated sequence also returns putative NSMase.
blastn of trimmed contig against C. gigas ESTs does not return any novel ESTs.
3-ketodihydrosphingosine reductase
homologene 1539
H. sapiens and D. melanogaster share 35% identity.
blastn of D. melanogaster mRNA (NM_143106.2) against C. gigas nucleotides and ESTs returned nothing.
tblastn of Dmel protein (NP_651363.1 ) against C. gigas ESTs returned 3 overlapping ESTs that span almost the entire length of the protein: AM853669.1 (e=9e-46), AM863021.1 (5e-30), AM857772.1 (4e-15). Only the first 2 assembled into a contig.
Extracted the consensus sequence (950 bp) and did blastx. Top hit is H. sapiens 3-KDSR (1e-84). Protein coding in the alignment starts at contig bp 134 and blastp of this translated segment returns 3-KDSR. blastn of the trimmed contig against other C. gigas ESTs does not return any novel sequences.
January 28, 2011
Ceramide pathway protein phylogeny
Based on Steven's alignments, found full protein coding sequence for sptlc1 in C. gigas.
Search for full coding region in Acid Sphingomyelinase
Human acid sphingomyelinase isoform 1 (SMPD1) accession number is NP_000534.3, homologene 457
aligned sequence with C. elegans (isoforms 1 and 2), C. familiaris, D. melanogaster and A. gambiae - there is a lot of homology between the vertebrates H. sapiens and C. familiaris, but less homology between the invertebrates and between verts and inverts.
blastn searches using C.elegans mRNA sequence for isoform 1 (NM_063014.5) of C. gigas nucleotide and EST sequences on GenBank yielded no returns.
tblastn of C. elegans protein sequence for isoform 1 (NP_495415.2) came up with C. gigas hits in the EST database (not nucleotide). The top hit was HS200764.1 (e=2e-45), but there was poor coverage of the sequence.
tblastx returned the same sequence as tblastn (e=9-50) but also with poor sequence coverage.
tblastn using H. sapiens protein sequence of the C. gigas ESTs also returned HS200764.1 (e=9e-72) with slightly better coverage, but still not complete.
Contigs from 454 sequencing data that matched to SMase are 21728 and 37057. blastx of both match to SMase 3b in M. musculus (P5824.1, e=8e-56) and human (Q92485.2, e=1e-75), respectively. Both contigs were trimmed and translated to match their top blast hits.
Homologene for SMase 3b is 8708. Protein sequences for C. elegans and H. sapiens show only 34% identity. tblastn of C. gigas ESTs with the C.elegans protein sequence returns HS199021.1, but the coverage isn't very good (e=5e-24). Putative SMase 3b Xenopus protein sequence is also in homologene (XP_002939398.1). tblastn of C. gigas ESTs returns the same EST as C. elegans but with much better coverage (e=1e-42).
megablast of HS199021.1 returns no other C. gigas EST hits.
Find a better gene....
Ceramide synthase 6 (Lass6) is highly conserved across taxa. Homologene #72228. H. sapiens and D. rerio sequences share 89% identity; Hsap, Drer and P. marinus (lamprey) share 65% homology. (P. marinus sequence is translated from an embryo EST starting at bp 6, accession number EG337115.1). blastn of D. rerio mRNA (XM_688191.3) against C. gigas nucleotides and ESTs yields no results. tblastn of D. rerio protein against C. gigas ESTs returns a number of hits, the top one being HS185280.1 (e=3e-55). According to the alignment, the coding regions overlap at C. gigas bp 58. pblast of this translated sequence returns as a top hit Lass6 (Q8C172.1, e=2e-65). blastn of the C.gigas EST returns 15 other C. gigas ESTs, but they all overlap completely and are of the same origin - mixed adult tissue libraries.
January 27, 2011
Ceramide pathway protein phylogeny
translated sptlc1 sequence to a stop codon in Geneious. This ends up being the translation of the reverse compliment of bp 1036-1821. the top pblast hit is serine plamitoyltransferase (1e-84).
January 25, 2011
Ceramide pathway protein phylogeny
Both the SMase and Sptlc1 protein sequences are missing some important amino acid residues that would be necessary for making a complete comparison with homologous proteins. SR found 5 C. gigas SMase sequences that align with the original EST. I did the alignment in Geneious and did a tblastx of the consensus sequence. The 3rd hit was D. rerio acid SMase 3b-like (e=6e-75). The alignment of our C. gigas sequence with the D. rerio started at bp 398, so I trimmed the consensus sequence and translated it in Geneious. I then did a pblast with the SwissProt db of this protein sequence, which returned protein information for acid SMase, the top hits being human, mouse, bovine, amoeba, and C. elegans acid SMase 3b-like. For information on protein structure see here. I redid the protein alignment in Clustal (with the same protein sequences previously used) and remade a phylogenetic tree in Geneious.
A pblast of the translated protein of Sptlc1 described 1.19.2011 also returned protein information in NCBI, found here.
January 21, 2011
Ceramide qPCR: SMase
qPCR of adult C.gigas tissues, vibrio exposed adult gill, and OA larvae.
Results: All amplified well and NTCs were clean.
January 20, 2011
Ceramide pathway protein phylogeny
Redid Sptlc1 tree with mRNA sequence translated in Geneious (same method as for SMase). Used all same protein sequences as previously described.
Ceramide qPCR: SMase
Received new SMase primers and reconstituted to 100 uM with TE buffer. qPCR using new SMase primers (CU995168_SMase) of adult C. gigas gill, mantle, muscle, and digestive gland.
Results: Amplified only in DG (amp plot beginning to come up very late for other tissues). No contamination in NTCs.
January 19, 2011
Ceramide pathway protein phylogeny (Sptlc1 and acid sphingomyelinase)
Sptlc1
EST sequence used to design primers overlaps completely with 454 contig 4852, which blasts with high confidence (e-value<10^-30) to Sptlc1 homologs. tlbastx of entire contig shows that the protein coding sequence begins ~bp 1000 (which still includes overlap with original Sptlc1 EST), so trimmed contig and new contig is comprised of bp1000-1879. Did tblastx of trimmed contig. Top hit was with Sptlc1 of Pong abelii (orangutan). Took translated protein sequence from this alignment (i.e. the one used by blast) and used it in alignment (this ends up being the reverse compliment of bp 1045-1821 translated). Other sequences taken from blast results are human (BAF84235.1), mouse (BAE36210.1), frog (NP_001084963.1), zebrafish (P_001018307.1), sea urchin (XP_793539), drosophila (NP_725256.1), C. elegans (NP_001021979.1), sea anemone (XP_001628145.1), and hydra (XP_002161793.1). Sequences were all aligned in ClustalX and alignment was imported into Geneious. Using the PhyML plug-in James-Taylor-Thornton model and 100 bootstraps, a maximum likelihood phylogenetic tree was made for the sequences.
Spingomyelinase (SMase)
C. gigas SMase EST (on which primers were designed) was blasted in tblastx. Protein alignments began at bp 218. The EST was translated in Geneious starting at bp 218 and this protein sequence was entered into protein blast to find homologs. Sequences taken from blast results for alignment are human (EAX07722.1), mouse (NP_598649.1), frog (XP_002939398.1), zebrafish (XP_692822.2), sea urchin (XP_786766.1), drosophila (XP_0013161994.2), C. elegans (NP_505620.3), and a hemichordate (XP_002737983.1). Sequences were aligned and tree was made as described for Sptlc1. (SMase2 is the C.gigas sequence)
January 12, 2011
SMase primer design
EST named "sphingomyelinase" in geneious BLASTs to other sphingomyelinases with e-values around e-40. C. gigas EST accession is CU995168. ORFs extend from ~25 to 743 bp on the reference and primers are designed to fall within this range (total sequence length is 780 bp). Forward sequence: TGGAGCATCGCTTACACAGC; Reverse sequence: ATCACACGGCATCACTTCGG. Product size is 159 bp starting at bp 467 and going to bp 625. See primer database for more details.
January 11, 2011
qPCR to test SMase primers
Did qPCR of 3 blank samples (water only) to find source of contamination seen in previous SMast NTCs on 12.10.2010. volumes of reagents per reaction were: 12.5 uL 2xImmomix, 10.5 uL water, 0.5 uL of each primer, 1.0 uL 50 uM SYTO13. Used qPCR protocol 3stepamp+melt_58annealing_ETS (45 cycles, 58C annealing).
Results: blank samples showed some amplification, but much less than what was seen in NTCs previously.
Made new 10 uM stocks of SMase primers. qPCR comparing old and new 10 uM primer stocks of NTCs (x3), NTCs without primer (x4), and cDNA template (x2). Used qPCR protocol 3stepamp+melt_58annealing_ETS.
Results: product amplification for old and new stock dilutions looked exactly like the NTCs with primers (NTCs without primers did not amplify at all). It appears that the primers do not work well and are probably amplifying primer dimer more than anything else. Need to redesign primers.
December 30, 2010
New notebook!
