Archive
Price Clontech Kit for making new Y2H library -Investigate follistatin literature and get something written.
Submit abalone DEG sequences to GenBank
ORDER primers in red -
ORDER- LPS-EB standard Standard LPS, E. coli 0111:B4 10 ng - 10 µg/ml PDF 5 mg tlrl-eblps check cart
from Invivogen -
Get price / Purchase replacement O-ring for fixed angle rotor (T-21)
MSTN
- Mate all Y2H baits with all Y2H preys on -LT, TDO plates initially.
- Construct new O.mykiss Y2H library
- Pool protein extract from 8 preys, run on gel along with co-ip elutant (use silver stain and new Ab for detection)
- Investigate: Y2H option: http://tinyurl.com/3rzgp3
Explore Vibrio microarray chip options
Order additional abalone primers (see recent paper, etc.)
FIND (if present) trout homolog for bone morphogenetic protein-1/tolloid (BMP-1/TLD) family of metalloproteases
in ESTs (OK, found a few EST clones: CA387524, BX878813, BX109543 when BLASTn with frog BMP-1 NM_001045671. Do we just want sequence/primers for gene expression or should I attempt to clone the entire CDS?)
Construct new y2h library (or find company to do it) (Current "quote" from Clontech, as of 5/28/2008, ~$14,500. This will create a normalized, full-length cDNA library cloned into pGADT7. To have them also transform this library into the appropriate yeast strain, the total cost of the entire project would be ~$20,000. To have a full-length, normalized, cDNA library made WITHOUT cloning into a vector would cost $8500.)
Purchase new pipets -
Prep one Vt plate for Carolyn -
Reserve room for Monday's FTR meeting -
Order Vibrio primers (next day if not done last week) -
Prices on new SpeedVacs are ~$6000 (7/23/2008)
Send protein spot for sequencing (8/19/2008)
Order Poly-A kits (75-1266) (8/18/2008. Also ordered Ambion Poly A Purist Kit.)
Order red primers (8/18/2008)
Order red primers (8/18/2008)
LAP, Telethonin, Decorin -> pBAD. (8/11/2008)
Run 16s Vt primers with larger experiment (8/11/2008)
REDO with Amplitaq /50: Run old Vt samples with 3 new primer pairs from Primer box 3 (No bands on gel. 8/11/2008. SJW)
Send Leslie 3-5ml tubes (Modified - Leslie will just freeze her samples and send them. 8/11/2008)
Run old Vt samples with 3 new primer pairs from Primer box 3 (8/8/2008 by Christin. No bands.)
ORDER two red primers (8/8/2008)
Reverse Transcribe Exp3 RNA ---- PCR (7/25/2008)
Spec hemo/vibrio RNA, correct, reverse transcribe (7/24/2008)
Extract RNA from Muscle Cell Experiment Three (cells in Tri-Reagent) (7/24/2008. JD)
Verify new FST primer works (7/23/2008)
Order red primers (7/23/2008)
Spec abalone GILL cDNA to use for normalization (7/23/2008)
Run Muscle cell cDNA with myogenin and Myod with SYBR @ 50 - once only (7/22/2008)
Think about next sequencing plate. what are we waiting for again?? (Additional sequences? We also want to have pBAD/FST sequenced with new 5' vector primer to verify frame. We have this primer. Should verify that it works via regular PCR, though.)
Laser Capture Microdissection available at UW: http://depts.washington.edu/diabetes/biomedcore/cmi.facilities.html , http://depts.washington.edu/imgcore/
Initial training to use the instrument costs $103. Usage of the instrument after that costs $36/hr. (7/20/2008)
Summarize # Y2H plates / bait / method (7/21/2008)
Create FASTA files with all the positive sequences FROM Y2H (e.g. make multiple files based on baits used). (7/21/2008)
Make Glycerol Stock of Vibrio, include special info on tube. (7/16/2008 SR)
Make DEPC water (7/16/2008)
Real-time on Ab gill samples: beta glucan recognition protein and RAB7-- sr # 203,204, 215,216 (7/15/2008. Oops. Actually done 7/18/2008)
Real-time on trout cDNA with new primers (7/15/2008)
Spec Ab cdNA (7/14/2008)
ORDER primers on sheet -red trout (including new Ab) (7/11/2008)
Ship RNAlater and tubes to Alaska
Assay abalone samples via qPCR, start with digestive gland samples
Run Abalone real-time with new standards (7/9/2008)
Run real time on trout muscle cells (Ran 18s 7/9/2008; possibly need new primers for brook trout?)
Extract manilla clam RNA (lots of tissue from live ones)
Extract pooled tissue "Ab02" - two tubes 6 ml (Steven 7/8/2008)
spec pooled RNA "Ab01"
spec muscle cell RNA
Extract RNA from plated clam hemocytes (7/7/2008)
Extract RNA from gill samples (manilla clam) (7/7/2008)
Order new pBAD seq. primer(s) for Follistatin - upstream of initial start codon (Received 7/2/2008)
Extract RNA from muscle cell cultures (Steven 7/2/2008)
Price Rat/HRP 2nd Ab (Purchased 7/2/2008)
Isolate mRNA from hard clam samples (7/1/2008)
Order Geneious
Add "wipe excess water out" to centrifuge checklist (7/1/2008)
Extract RNA from Hard Clam samples Jackie Sent (6/30/2008)
Look into protein sequencing procedures/costs. (1-D and 2-D) ($250/digested sample; reagents for digestion ordered 6/30/2008)
Graph data from CTs, note not detected and sample size
Determine Sample type for prostaglandin assay
clam: Plate hemocytes
TA Clone Gigas COX RACE products
Next FTR coffee should be next Friday...
RACE C.gigas COX (PGS) (Success! 6/20/2008)
Mount Katie's Poster
Fill out Social Services form (see me) (Faxed in filled form 6/16/2008)
ORDER stuff (if necessary) for plating hemocytes (6/13/2008)
ORDER Silver-Stain -- myostatin budget (6/13/2008)
PRICE Silver Stain for protein gels (Invitrogen, 25 minigels=$210,
Determine what we need to plate manilla clam hemocytes like what was done with oyster (last paper) (Need 60mm culture plates, poly-lysine, penicillin, streptomycin, smaller needles(?) (larger gauge). 6/12/2008)
Determine what we need to replace in Library kit, Packaging extract? ? (Yep, this is what we need. How many rxns, though? That I don't know. Any thoughts from past experience? 6/11/2008)
Determine what POWER we need for Proteomics gel
1) get quote
2) See if Hauser lab has one.
Determine if all components in RACE kit. (Good to go! Have to use Advantage 2 Polymerase and buffer from SMART library kit, though. 6/9/2008)
Test Bioline against Carolyn's (Compared to Carolyn's, our Immomix looks OK. 6/5/2008)
GET powerpoints from Katie and Cullen (Done. 6/4/2008)
LOCATE Steph and Cullens Ab Poster (Steph has it at home and will bring it next time she is in. 5/30/2008)
Find additional normalizing genes for abalone. (Ordered actin primers based upon sequence homology of other Haliotis sp. 5/23/2008)
Check DQ sequences to verify blast hits cover 100% of sequence. (Investigating discrepancies in set of sequences. Sequences look OK after alignment with full-length sequence/primers. 5/23/2008)
Confirm QPX-like sequences with re-sequences from a few months ago. (Did alignment, but we only have two Lab sequences. 5/21/2008)
Submit the following to NCBI (Submitted 5/14/2008)
>plancitoxin
GCGGGTCGCTCCTGTGGGTGCCTCGGTGCGTCATGACTCGGGCCACTTCT
ACATGGACGTCAACAACCCCACGTGGACTCTGTCCAAAGTCCTCATGAAG
GACCCGAAACACGCCGTCTACAACACGCTCCAGACAATATACCAGGCCAA
AACTACTGATGACTTCGCGTACGTTATGTACAATGACAAAACTCCAGCTG
GAAAAGAACCAGAGAGCGACGGACATTCAAAAGGTGTATTTGCTTTTGAC
AAGGAAGCGGGGTTTTGGCTGGTGCATAGCACCCCTGGGTTTCCACCAAA
CCGTGCAGATGGCTACAACTGGCCTGATACTGCTCTCGTCAATGGGCAAA
GCTTTCTCTGTGTTTCTTACACTTATTCACAGCTGAACAACATCGCCTCC
CAGATCGTGTACAACTATGTACAAGTGTATGACCAAATGGCCTCGGCGAG
CTTCCTGTCTGGCAACCCGAGTCTGGCCGCAGTCATCAACCACAAACATC
CAGGACGAACAACCGCCAACAAGCTCCAGCTGACGTCCAAACAGGGCACA
CCAT
>beta-glucan recognition protein
GGGAGGAGGTCCTCACGACACCTGTACCGGCAACGCATTCTACGGCTGTG
AGCGCACCGGCAGCAACGCCAACATCATCAACCCTATTCAGTCCGCCCGA
CTCCGGAGCTCCAGGGGTCTGAACTTTAAATACGGCAAGGTGGAAATATC
GGCTCAGCTCCCCAAGGGAGACTGGCTGTGGCCCGCCATATGGATGCTGC
CGACGTACACGGAGTATGGCCGTTGGCCGGCGTCCGGCGAGATTGACATC
ATGGAGAGCAGAGGTAACCGACACTACTACGACGCGAATGGCCGCTCTGT
CGGGGTGGACGCTTACGGCAGCACTCTTCACTTCGGCCCCGACTACTTCA
ACAACGGCTGGTCACGTGCCCACCAGTCCTGGGTCAAA
Fix alarm (Claire's phone numbers are entered in. Alarm may or may not respond correctly, though. Don't know why. 5/9/2008)
Confirm SAFS transfer of money for Capstones and RCR - These allocations include RCR returns for expenditures 7/06 through 6/07. They also include special allocations for matching, capstone, recapture - and should be up to date through the end of March. (Budget revision #006463 has been made to transfer Capstone funds in the amount of $350 for Cullen and Steph for Winter 08, according to Laurie Bryan. I do not know when this will go through. Checking on Tushara's share. 5/7/2008)
ID numbers to call (24) for power problems (Number during reg. hours = 206-683-3010. Number for after hours = 206-685-1480. 5/7/2008)
Fix electric issue in 4 degree (Currently working as of 5/7/2008. Does not mean the previous issue is fixed, though.)
Find best freezer and Order (5/8/2008)
Complete DRAFT of follistatin manuscript methods section. (This has been done for a bit, just neglected to remove it from the list. It has been shared with you via Google Docs. 5/7/2008)
Purchase White Board sheets (Received 5/7/2008)
*FIND MORE microarrays that might be available for genuses: Anaplasma, Ehrlichia, Wolbachia, Neorickettsia (Quote requested for slides of all species except Neorickettsia from NimbleGen 5/1/2008).Q: WHO is D... with access to purchasing log? (Christin is Doc91... or whatever it says.)
Q:looking at the sequence log, did we not do several more LABYs (We have LABY submissions on 2/15/2008 and 3/5/2008. That's all we've done with that.)
Reinvestigate the following, links seem to be broken (New Rickettsia microarray link 04232008: http://pfgrc.jcvi.org/index.php/microarray/available_microarrays.html )
(New Rickettsia clone library link 04232008: http://pfgrc.jcvi.org/index.php/gateway_clones/available_libraries.html )
Check out new Stratagene offer 4/21/08 (placed an order 04222008; unfortunately not part of the offer, but we needed it.)
Submit Black Abalone Cytocrhome C oxidaes to genebank (Submitted 04082008)
Assay qpx samples
Complete remaining oyster samples for 24 hour vibrio
TRY to get the paper---- http://tinyurl.com/2hcajj (Not available in U.S. for 12 months after initial publish date. So, we won't have access until Nov. 2008)
Regrow QPX in new media (Recultured from original cultures 3/25/2008)
RESERVE LCD projector for FTR coffee hour (Reserved 3/20/2008)
SEND email for March FTR coffee. (Sent 3/18/2008)
DETERMINE % ORF on two Follistatin genes and putative intron sites (ORF = 100% on both FST and FSTL. Have put. intron sites identified as well.)
Determine if we have the following for trout
bone morphogenetic protein-1/tolloid (BMP-1/TLD) family of metalloproteases. (We do not. We have BMP and activin membrane-bound inhibitor homolog (BAMBI). Based on Acc# NM_012342)
ORDER Delta-6 primers (Ordered 03/17/2008)
Update sequence log with 021508 sequence information
OBTAIN ProCard (Application submitted. Signed up for training on March 21, 2008)
Find out if Clontech offers Two-hybrid service? (Not listed in their "Services" section of their website. Will call, though.)
Contact Clontech regarding the re-occurence of hits on different baits?
Locate Freeze-drier (Shindler's lab in FSH)
Determine if Recombinant MSTN is available for purchase that might work in fish. Try Gro-Prep ? an Australian company? (Recombinant MSTN is available from a number of sources)
Get prices for company to make protein in e. coli. Should be around 1000 for a decent amount
maybe rockland immunological, others? (Rockland is ~$1500 for 1L of bugs)
ORDER large plastic Beakers (~4L)
See about getting ATP-1? from See-Gene (Ordered 2/8/2008)
ORDER Red highlighted primers (2 pair -C. gigas) (Ordered 2/5/2008)
Make up saline peptone
Lyse, resuspend, Dialyze pBAD MSTN
ORDER Primer highlighted in Red (I don't see a red-highlighted primer. 1/22/2008)
ORDER more phenol chloroform isoamyl
Dispose of oyster carcasses
Share / show calendar to Adelaide
Get Prices for sonicator ie Fisher, VWR, Denville?
Purchase large bottle for centrifuge (Currently have 6 as of 1/16/2008))
Figure Costs for thermocycler lid replacement (Bio-Rad: $562.59. Waiting for quote from GMI as of 1/16/2008)
CHECK broken PCR machine with water (It works! No evaporation!)
GROW / purify MSTN in pBAD
Transfer newly highlighted pink stuff on purchasing log to MSTN grant (Completed for all but Invitrogen order as of 1/15/2008. Will be notified when completed.)
Get Someone to Extract genomic DNA from gigas (maybe Steph or Katie)
DETERMINE if we currently have a post for Work-Study positions online (Yes, as of 1/14/2008)
Get some DRI-RITE for flourescent dye storage
Return Large culture flasks
REMOVE water from glass aquaria in FSH-- maybe move to big system?
update MSTN Y2H multi-seq FASTA, and upload to gdocs
Ricketssia chip and more...
Alrighty, here's what I was able to find. A Rickettsia chip appears to be available through TIGR. Here's the link to the chip description and links for ordering: http://pfgrc.tigr.org/slide_html/array_descriptions/R_prowazekii.shtml
Apparently to obtain a chip, researchers have to apply (which is a rolling process) for approval and then the chips are provided free of charge.
Additionally, they also offer a Rickettsia library cloned into the Invitrogen Gateway vector system: http://pfgrc.tigr.org/servlet/pfgrc/fir/select_organism.jsp (Scroll down to look at info for Rickettsia).
That's all I could find. Other uses of arrays in the literature were custom jobs and, as such, aren't available publicly. If you're interested in any of those papers for possibly contacting the authors, let me know; I have them saved in Papers.
Page History
| Date | Author | Comment | ||
|---|---|---|---|---|
| More Revisions | ||||
| Dec 23, 2010 9:38 am | ||||
| Oct 2, 2009 12:48 pm | ||||
| Oct 2, 2009 12:47 pm | ||||
| Dec 31, 2008 1:41 pm | ||||
| Dec 29, 2008 7:28 pm | ||||