May 26, 2011
About the Tert Primers
On_GE619911_tert_F: ATCTTCCCCTCCCATGTTGT (60.57C melting temp)
On_GE619911_tert_R: GATCGGTCAGTGTTGTGCTG (60.32C melting temp)

---

May 13, 2011
qPCR reagents

Reagent	Volume (µL)	Final Concentration	Volume needed for 32 reactions (µL)
2x SsoFast EvaGreen	10	1x	320
O. mykiss 18s Forward Primer (10µM)	0.2	0.1 µM	6.4
O. mykiss 18s Reverse Primer (10µM)	0.2	0.1 µM	6.4
PCR H2O	7.6	---	243.2
Template	2	---	---

Total SsoFast reaction is 20µL (18µL master mix and 2µL template).

Plate layout

	1	2	3	4
A	0_A	S_A	0_C	S_C
B	0_B	S_A	0_D	S_D
C	0_D	S_B	pH_A	H2O
D	0_C	S_C	pH_B	H2O
E	pH_A	S_D	pH_C
F	pH_B	H2O	pH_D
G	pH_C	0_A	S_A
H	pH_D	0_B	S_B

Cycling parameters
98°C: 2 minutes

98°C: 2 seconds
60°C: 5 seconds
(repeat 39 times)

65°C to 95°C (0.2°C increments): 10 seconds

18s, Tert Analysis

---

May 12, 2011
qPCR worked!

---

May 11, 2011
I ran a qPCR for each DNased 1:4 diluted cDNA sample sample using GE primers.
qPCR reagents

Reagent	Volume (µL)	Final Concentration	Volume needed for 32 reactions (µL)
2x SsoFast EvaGreen	10	1x	320
GE619911 Forward Primer (10µM)	0.2	0.1 µM	6.4
GE619911 Reverse Primer (10µM)	0.2	0.1 µM	6.4
PCR H2O	7.6	---	243.2
Template	2	---	---

Total SsoFast reaction is 20µL (18µL master mix and 2µL template).

Plate layout

	8	9	10	11
A	0_A	S_A	0_C	S_C
B	0_B	S_B	0_D	S_D
C	0_D	S_C	pH_A	H2O
D	0_C	S_D	pH_B	H2O
E	pH_A	H2O	pH_C
F	pH_B	H2O	pH_D
G	pH_C	0_A	S_A
H	pH_D	0_B	S_B

Cycling parameters
98°C: 2 minutes

98°C: 2 seconds
60°C: 5 seconds
(repeat 39 times)

65°C to 95°C (0.2°C increments): 10 seconds

---

May 10, 2011
Agarose Gel, Electrophoresis
100mL modified 1x TAE and 0.82g agarose were mixed in a 500mL Erlenmeyer Flask. The mass of the flask with this mixture was recorded at 303.44g. The mixture was heated for 2 minutes in a microwave. The mixture was swirled to ensure complete mixing. The flask was weighed again and the mass of the flask was brought back up to 305.72g by adding NanoPure water. The mixture was allowed to cool for 20 minutes. 10µL ethidium bromide was added to the mixture and swirled in. The mixture was poured into a gel mold box and a 16-well comb was used to make 1.5cm wells. The gel was allowed to set for 45 minutes before removing the comb. The gel was placed in an electrophoresis box and covered with modified 1x TAE. 5µL Hyper I Ladder was added to lane 1. The 25µL samples were added to separate lanes. The gel was run for 45 minutes at 100V.

---

May 9, 2011
18s PCR products were run on 0.8% Agarose gel. I also ran PCR using the GE primers again, this time, with all of the samples. I'll use this to compare with the 18s reference I'm running on an agarose gel.
Agarose Gel, Electrophoresis
100mL modified 1x TAE and 0.82g agarose were mixed in a 500mL Erlenmeyer Flask. The mass of the flask with this mixture was recorded at 303.44g. The mixture was heated for 2 minutes in a microwave. The mixture was swirled to ensure complete mixing. The flask was weighed again and the mass of the flask was brought back up to 305.72g by adding NanoPure water. The mixture was allowed to cool for 20 minutes. 10µL ethidium bromide was added to the mixture and swirled in. The mixture was poured into a gel mold box and a 16-well comb was used to make 1.5cm wells. The gel was allowed to set for 45 minutes before removing the comb. The gel was placed in an electrophoresis box and covered with modified 1x TAE. 5µL Hyper I Ladder was added to lane 1. The 25µL samples were added to separate lanes. The gel was run for 45 minutes at 100V.



GE PCR
18s primers for Onchorynchus mykiss primers were used as a reference. 18s Master Mix was created for 16 reactions. Each separate PCR reaction was 25µL. 14 total reactions were run (two of them were negative controls). 23µL Master Mix was combined with 2µL template in separate wells of a PCR plate.

Reagent	Volume (µL)	Final Concentration	Volume needed for 16 reactions (µL)
2x Apex Red	12.5	1x	200
GE Forward Primer (10µM)	0.4	0.2 µM	6.4
GE Reverse Primer (10µM)	0.4	0.2 µM	6.4
NanoPure H2O	9.7	---	155.2
Template	2	---	---

GE PCR Plate Layout

	3	4
A	0_A	S_A
B	0_B	S_B
C	0_C	S_C
D	0_D	S_D
E	pH_A	H2O
F	pH_B	H2O
G	pH_C	---
H	pH_D	---

GE Cycling Parameters
*Heated Lid
95°C: 10 minutes

95°C: 15 seconds
60°C: 15 seconds
72°C: 30 seconds
(repeat 39 times)

72°C: 10 minutes
4°C: hold until storage in -20°C

---

May 6, 2011
DNase
In separate, sterile 0.5mL tubes, I combined 50µL RNA, 5µL 10X Turbo DNase Buffer, 1µL Turbo DNase (routine DNase treatment methods) and mixed via vortexing for 10 seconds and quickly spun down for 7 seconds. This mixture was incubated at 37°C for 30 minutes in a thermal cycler. A tube of Inactivation Reagent was mixed via vortexing for 30 seconds. 5µL Inactivation reagent was added to each tube. Each tube was vortexed for 10 seconds and left to incubate at room temperature for 2.5 minutes. Each tube was vortexed for 5 seconds and left to incubate at room temperature for another 2.5 minutes. The tubes were spun in a refrigerated centrifuge at 10,000g for 1.5 minutes. A pellet formed at the bottom of each tube. 50µL of the remaining liquid was pipetted into separate, sterile 0.5mL tubes.

Reverse Transcription
In separate, clean PCR tubes, 5µL RNA, 1µL Oligo DT, and 4µL NanoPure water were combined. The mixture was spun in a refrigerated centrifuge for 7 seconds to pool at the bottom. The tubes were placed in a thermal cycler at 70°C for 5 minutes, then taken off and transferred to an ice bucket. 5µL M-MLV(5X), 5µL dNTPs, 1µL M-MLV RT, and 4µL NanoPure water were added to each tube. Each tube was spun for 7 seconds in a refrigerated centrifuge. The tubes were incubated in a thermal cycler at 42°C for 60 minutes. The temperature was raised to 70°C for 3 minutes. The tubes were taken out of the thermal cycler and placed in my -20°C box.

18s PCR
18s primers for Onchorynchus mykiss primers were used as a reference. 18s Master Mix was created for 16 reactions. Each separate PCR reaction was 25µL. 14 total reactions were run (two of them were negative controls). 23µL Master Mix was combined with 2µL template in separate wells of a PCR plate.

Reagent	Volume (µL)	Final Concentration	Volume needed for 16 reactions (µL)
2x Apex Red	12.5	1x	200
18s Forward Primer (10µM)	0.4	0.2 µM	6.4
18s Reverse Primer (10µM)	0.4	0.2 µM	6.4
NanoPure H2O	9.7	---	155.2
Template	2	---	---

18s PCR Plate Layout

	1	2
A	0_A	S_A
B	0_B	S_B
C	0_C	S_C
D	0_D	S_D
E	pH_A	H2O
F	pH_B	H2O
G	pH_C	---
H	pH_D	---

18s Cycling Parameters
*Heated Lid
95°C: 10 minutes

95°C: 15 seconds
50°C: 15 seconds
72°C: 30 seconds
(repeat 39 times)

72°C: 2 minutes
4°C: hold until storage in -20°C

---

May 4, 2011
The plan from here is to DNase all of my RNA samples, reverse transcribe, and make a 1:4 dilution of cDNA to work with.

---

May 3, 2011
Results of yesterday's qPCR






Amplification was detected in all wells (including all four negative controls) except for the well in which I put 2µL cDNA. I have to make more cDNA. In the next qPCR runs, I'm only going to use 1µL template. In wells where there is template, there is a product detected that melts at around 82°C in addition to the product at 75°C.

---

May 2, 2011
I'll try the On_GE primers again using less primers and less template. I'm using less primers to try and minimize or eliminate primer dimer and less template because having too high a starting concentration of template can inhibit qPCR.

Reagent	Volume (µL)	Final Concentration	Volume needed for 10 reactions (µL)
2x SsoFast EvaGreen	10	1x	100
GE619911 Forward Primer (10µM)	0.2	0.1 µM	2
GE619911 Reverse Primer (10µM)	0.2	0.1 µM	2
PCR H2O	7.6	---	76
Template	2	---	---

Total SsoFast reaction is 20µL (18µL master mix and 2µL template).

*I wanted to do 2µL reactions, but I didn't have enough template for that. I only had enough for one 1µL reaction for 0_A and pH_A. I had enough for one 1µL reaction and one 2µL reaction for S_D
A 0_A (1µL + 19µL MM)
B H2O
C pH_A (1µL + 19µL MM)
D H2O
E S_D (1µL + 19µL MM)
F S_D (2µL + 19µL MM)
G H2O
H H2O

---

April 27, 2011

Gel Methods
75mL modified 1x TAE and 0.61g agarose were mixed in a flask. The mass of the flask with this mixture was recorded at 201.26g. The mixture was heated for 90 seconds in a microwave. The mixture was swirled to ensure complete mixing. The flask was weighed again and the mass of the flask was brought back up to 204.15g by adding NanoPure water. The mixture was allowed to cool for 15 minutes. 7.5µL ethidium bromide was added to the mixture. The mixture was poured into a gel mold box and a 12-well comb was used to make 1.5cm wells. The gel was allowed to set for 40 minutes before removing the comb. The gel was placed in an electrophoresis box and covered with modified 1x TAE. 5µL Hyper I Ladder was added to lane 1. The 25µL samples were added to separate lanes. The gel was run for 60 minutes at 100V. I made a mistake loading pH_A (BX primer). I pierced the gel just below the well I was trying to load it in. The sample embedded in the gel and it just looks like a small pink spot. I skipped the adjacent lane just in case any of that sample migrated into the next well.

---

April 26, 2011

Master Mix (BX)**

Reagent	Volume (µL)	Final Concentration	Volume needed for 5 reactions (µL)
2x Apex Red	12.5	1x	62.5
BX Forward Primer (10µM)	0.5	0.2 µM	2.5
BX Reverse Primer (10µM)	0.5	0.2 µM	2.5
NanoPure H2O	9.5	---	47.5
Template	2	---	---

Master Mix (GE)

Reagent	Volume (µL)	Final Concentration	Volume needed for 5 reactions (µL)
2x Apex Red	12.5	1x	62.5
GE Forward Primer (10µM)	0.5	0.2 µM	2.5
GE Reverse Primer (10µM)	0.5	0.2 µM	2.5
NanoPure H2O	9.5	---	47.5
Template	2	---	---

Cycling Parameters
*Heated Lid
95°C: 10 minutes


95°C: 15 seconds
60°C: 15 seconds
72°C: 30 seconds
(repeat 39 times)


72°C: 10 minutes
4°C: hold until storage in -20°C box - kubu4Put samples in Jason's -20C.

---

April 25, 2011

Today, I made new BX primer stock and I'm testing these primers again to make sure I didn't get BX and GE confused with one another. I know that one of them worked (April 8, 2011). I just need to make sure which one that was.

10µM Primer Stock
In separate sterile 1.5mL test tubes, I mixed 10µL primer (100µL) with 90µL nanopure water.

Master Mix**

Reagent	Volume (µL)	Final Concentration	Volume needed for 5 reactions (µL)
2x Apex Red	12.5	1x	62.5
BX Forward Primer (10µM)	0.5	0.2 µM	2.5
BX Reverse Primer (10µM)	0.5	0.2 µM	2.5
NanoPure H2O	9.5	---	47.5
Template	2	---	---

Cycling Parameters
95°C: 10 minutes

95°C: 15 seconds
60°C: 15 seconds
72°C: 30 seconds
(repeat 39 times)

72°C: 10 minutes
4°C: hold until storage in -20°C box - kubu4Samples were stored in Jason's -20C box. However, the samples were fully evaporated upon removal from thermal cycler. This suggests that the PCR run did NOT use a heated lid (which is necessary to prevent evaporation of the samples during cycling).

---

April 21, 2011
I ran my PCR products from yesterday on a gel and didn't see any bands. I don't think I mixed up the primers, but I'm starting to think it might be possible. I can't imagine how there was no amplification in qPCR after seeing such a strong band in traditional PCR. I'll make new BX primer stock and separate it from everything else and run PCR with that and run another gel.

Agarose Gel, Gel Electrophoresis
50mL of modified 1X Tris-Acetate-EDTA was mixed with 0.40g Agarose (0.8% Agarose solution). The flask was weighed (171.2g) and heated for 90 seconds in a microwave. The heated mixture was swirled to ensure complete dissolution of Agarose. Deionized water was added to the flask to bring the mass back up (175g). It was left to cool at room temperature for 10 minutes. 5.0 μL Ethidium Bromide was added to the mixture. It was poured into a gel mold with an 8-well comb (1.5mm wells) and allowed to set for 30 minutes. The gel was placed in a gel box and covered with TAE. 5 μL Hyper I Ladder, each 20-μL sample, and controls were loaded into separate wells and the gel was run at 63V for 90 minutes. The gel was removed, then viewed and photographed under UV light.

---

April 20, 2011
I've run into a few issues. Melting temperature of the GE619911 primers is 56°C. The gel I ran was with a 55°C annealing temperature. There were really bright bands in the area of primer dimer, but way too bright to disregard. However, in qPCR, I didn't amplify anything at 55°C annealing temperature. I'll try raising the temperature to 60°C in traditional PCR to see what that does to the primer dimer. I could also try using an annealing/denaturing step of 53°C in qPCR to see if I can get any amplification.


Master Mix

Reagent	Volume (µL)	Final Concentration	Volume needed for 5 reactions (µL)
2x Apex Red	12.5	1x	62.5
GE Forward Primer (10µM)	0.5	0.2 µM	2.5
GE Reverse Primer (10µM)	0.5	0.2 µM	2.5
NanoPure H2O	9.5	---	47.5
Template	2	---	---

Cycling Parameters
95°C: 10 minutes

95°C: 15 seconds
60°C: 15 seconds
72°C: 30 seconds
(repeat 39 times)

72°C: 10 minutes
4°C: hold until storage in -20°C box

---

April 18, 2011
I'll use On_GE619911_tert primers that gave strong bands in traditional PCR last week.

Reagent	Volume (µL)	Final Concentration	Volume needed for 30 reactions (µL)
2x Sso Fast EvaGreen	10	1x	300
Forward Primer (10µM)	0.5	0.2 µM	15
Reverse Primer (10µM)	0.5	0.2 µM	15
PCR H2O	5	---	150
Template	4	---	---

qPCR plate layout

	1	2	3	4	5	6	7	8
A	0_A (new)	0_A (new)	pH_A (new)	pH_A (new)	S_D (new)	S_D (new)	H2O	H2O
B	0_A (old)	0_A (old)	pH_A (old)	pH_A (old)	S_D (old)	S_D (old)	H2O	H2O
C	0_A (RNA)	0_A (RNA)	pH_A (RNA)	pH_A (RNA)	S_D (RNA)	S_D (RNA)	H2O	H2O

Cycling parameters
98°C: 2 minutes

98°C: 2 seconds
55°C: 5 seconds
(repeat 39 times)

65°C to 95°C (0.2°C increments): 10 seconds

---

April 8, 2011

Gel Methods
75mL modified 1x TAE and 0.61g agarose were mixed in a flask. The mass of the flask with this mixture was recorded at 231.9g. The mixture was heated for 90 seconds in a microwave. The mixture was swirled to ensure complete mixing. The flask was weighed again and the mass of the flask was brought back up to 234g by adding NanoPure water. The mixture was allowed to cool for 15 minutes. 7.5µL ethidium bromide was added to the mixture. The mixture was poured into a gel mold box and a 12-well comb was used to make 1.5cm wells. The gel was allowed to set for 40 minutes before removing the comb. The gel was placed in an electrophoresis box and covered with modified 1x TAE. 5µL Hyper I Ladder was added to lane 1. The 25µL samples were added to separate lanes. The gel was run for 60 minutes at 100V.

Arrangement of the samples:

Lane 1	Lane 2	Lane 3	Lane 4	Lane 5	Lane 6	Lane 7	Lane 8	Lane 9
Hyper I Ladder	BX cDNA 1	BX cDNA 2	BX RNA	BX H2O	GE cDNA 1	GE cDNA 2	GE RNA	GE H2O

Results

---

April 6, 2011
Using two sets of primers that Caroline Designed, I'm running a traditional PCR to find out which one of those works best.

Primers
On_GE619911_tert_F
On_GE619911_tert_R

On_BX889962_tert_F
On_BX889962_tert_R

In separate tubes, I made 100µL of 10µM working stocks by combining 10µL primer (100µM) with 90µL NanoPure water. I used those primers to make two different master mixes: GE and BX.

Master Mix

Reagent	Volume (µL)	Final Concentration	Volume needed for 10 reactions (µL)
2x Apex Red	12.5	1x	125
Forward Primer (10uM)	0.5	0.2 µM	5
Reverse Primer (10uM)	0.5	0.2 µM	5
NanoPure H2O	9.5	---	95
Template	2	---	---

I have 3 different samples I'm trying to amplify: cDNA (3/22/2011), cDNA (3/31/2011), and RNA with gDNA carryover. For a negative control, I have two NanoPure water samples.

Cycling Parameters
95°C: 10 minutes

95°C: 15 seconds
55°C: 15 seconds
72°C: 30 seconds
(repeat 39 times)

72°C: 10 minutes
4°C: hold until storage in -20°C box

When I run this on a gel, I'll put a little ethidium bromide in my running buffer.

---

April 5, 2011
I'm using 2x Sso Fast EvaGreen Supermix instead of 2x Immomix.

Reagent	Volume (µL)	Final Concentration	Volume needed for 30 reactions (µL)
2x Sso Fast EvaGreen	10	1x	300
Forward Primer (10uM)	0.5	0.2 µM	15
Reverse Primer (10uM)	0.5	0.2 µM	15
PCR H2O	5	---	150
Template	4	---	---

Cycling parameters are dependent on concentrations of cDNA and gDNA. Since I haven't standardized yet, I just used standard gDNA protocol that was programmed into the BioRad software.

qPCR plate layout

	1	2	3	4	5	6	7	8
A	0_A (new)	0_A (new)	pH_A (new)	pH_A (new)	S_D (new)	S_D (new)	H2O	H2O
B	0_A (old)	0_A (old)	pH_A (old)	pH_A (old)	S_D (old)	S_D (old)	H2O	H2O
C	0_A (RNA)	0_A (RNA)	pH_A (RNA)	pH_A (RNA)	S_D (RNA)	S_D (RNA)	H2O	H2O
D	H2O	H2O	H2O	H2O	H2O	H2O	H2O	H2O

I made two sets of master mix because I thought I messed up on the first one. But I used it for all of row D.

Cycling parameters
98°C: 2 minutes

98°C: 2 seconds
55°C: 5 seconds
(repeat 39 times)

65°C to 95°C (0.2°C increments): 10 seconds

---

March 31, 2011
I'm going to try reverse transcribing the same RNA samples again. I'll run those samples along with the cDNA I made last week, a couple of negative controls, and positive controls (using the same RNA samples with known gDNA carryover).

qPCR Reagents

Reagent	Volume (µL)	Final Concentration	Volume needed for 30 reactions (µL)
Master Mix (2X Immomix)	25.0	1X	750
Syto-13 Dye (50 µM)	2.0	2.0 µM	60
Forward Tert Primer (10 µM)	2.5	0.5 µM	75
Reverse Tert Primer (10 µM)	2.5	0.5 µM	75
Ultra Pure H2O	14.0	N/A	420
cDNA	4.0 µL/reaction

Cycling parameters
95°C: 10 minutes

95°C: 10 seconds
55°C: 10 seconds
72°C: 30 seconds
(repeat 39 times)

95°C: 10 seconds
60°C: 5 seconds
95°C-0.5°C

---

March 30, 2011
I've been given three suggestions on how I might go about troubleshooting my qPCR.
1. Increase [MgCl2]
-I've been using 3.0 mM, which is the standard concentration in Immomix
2. Increase [template]
-Although I haven't standardized my cDNA concentrations yet.
3. Increase [primer]
-I've been using 0.5 µM

---

March 23, 2011
I didn't get any amplification this time around. My annealing temperatures were 59, 57, and 55°C.
I know that the denaturing and annealing steps were each 5 seconds shorter than my first run, but could that really have made that much of a difference? Could it be an error in my methods? I did follow each step carefully though. I'm pretty confident I followed each step for making cDNA from Environmental Physiology.

---

March 22, 2011
Methods for Reverse Transcription of RNA
I reverse transcribed 3 samples, each from a different treatment group. I used 0_A, pH_A, and S_D because they had the lowest C(t) values within their respective treatments. Frozen RNA was removed, thawed, and mixed by inverting the tube several times. In a clean PCR tube, 5µL RNA was combined with 1µL oligo dT and 4µL PCR water. That mixture was centrifuged for 10 seconds to pool the reagents at the bottom of the tube. The PCR tube was heated at 70°C for 5 minutes in a thermocycler. It was removed and placed on ice. 5µL M-MLV 5X reaction buffer, 5µL dNTP, 1µL M-MLV RT, and 4µL H2O were added to the tube. The mixture was centrifuged for 10 seconds and incubated in a thermocycler at 42°C for 60 minutes. The temperature was then raised to 70°C for 3 minutes.

Annealing step on my first qPCR was 55°C. I'll test four different annealing temperatures higher than 55°C.


qPCR Reagents

Reagent	Volume (µL)	Final Concentration	Volume needed for 36 reactions (µL)
Master Mix (2X Immomix)	12.5	1X	450
Syto-13 Dye (50 µM)	1	2.0 µM	36
Forward Tert Primer (10 µM)	1.25	0.5 µM	45
Reverse Tert Primer (10 µM)	1.25	0.5 µM	45
Ultra Pure H2O	7.0	N/A	252
cDNA	2.0 µL/reaction

Cycling parameters
95°C: 10 minutes

95°C: 10 seconds
59.0°C/57.8°C/55.5°C: 10 seconds
72°C: 30 seconds
(repeat 39 times)

95°C: 10 seconds
60°C: 5 seconds
95°C-0.5°C

---

March 21, 2011
Results from qPCR of RNA samples
There is genomic DNA carryover in my RNA stock. Water samples were all clean. The problem with the DNA carryover is that looking at the melting curves, it looks like there are multiple PCR products (70°C and 80°C). The secondary product has the higher melting temperature, meaning that it takes a higher temperature to break the hydrogen bonds of the fluorescent double-stranded DNA. Higher melting temperature means it's probably a longer product. The product I expect to see is 202 base pairs long. When I performed traditional PCR, I was consistently amplifying a product that was longer than 200bp (see March 2 entry). I thought the pesticide and LPS treatment was doing something funny to that group, but now I'm not so sure. I need to see if raising the annealing temperature during qPCR will eliminate this secondary product.

To-do
-Don't DNase yet
-Make cDNA from one sample from each of the treatment groups (preferably, the ones with the lowest C(t) (high fluorescence) values). (I know I can't distinguish cDNA from genomic DNA. I just need to know if I can at least control for one product).
-qPCR with a temperature gradient (2 samples per temperature). I need to try to optimize the assay to eliminate that second product (melted at 80°C) I see from the melting curve data. So at the annealing step, we'll test higher and higher temperatures so that the primers (hopefully) won't anneal to the other sequence.
-Use two negative (water) controls for each temperature also (total of 8 samples per temperature).
-Find the right annealing temperature before worrying about genomic DNA carryover.
-After optimizing the assay, then I can DNase all of the RNA.

---

March 18, 2011
Thanks Dave for throwing my plate on the qPCR machine!

Cycling parameters
95°C: 10 minutes

95°C: 15 seconds
55°C: 15 seconds
72°C: 30 seconds
(repeat 39 times)

95°C: 10 seconds
65°C: 5 seconds
95°C-0.5°C

---

March 17, 2011
To check for DNA carryover, I need to run 12 qPCR reactions with my RNA samples plus a negative control, all with replicates (26 total reactions).

qPCR Reagents

Reagent	Volume (µL)	Final Concentration	Volume needed for 28 reactions (µL)
Master Mix (2X Immomix)	12.5	1X	350
Syto-13 Dye (50 µM)	1	2.0 µM	28
Forward Tert Primer (10 µM)	1.25	0.5 µM	35
Reverse Tert Primer (10 µM)	1.25	0.5 µM	35
Ultra Pure H2O	7.0	N/A	196
cDNA	2.0 µL/reaction

---

March 14, 2011
I'm re-quantifying all of my samples. This time, I'm going to quantify the same sample three times in a row.

	Concentration (ng/µL)	A260/A280	A260/A230
0_A	1225.5	1.97	2.10
	1211.6	1.97	2.08
	1236.2	1.97	2.09
0_B	1456.4	1.98	1.92
	1385.3	1.99	1.91
	1467.1	1.98	1.92
0_C	803.0	1.91	2.24
	806.8	1.92	2.22
	802.9	1.92	2.25
0_D	1227.7	1.92	2.15
	1205.8	1.98	2.12
	1205.5	1.97	2.11
pH_A	1468.2	1.92	1.93
	1618.0	1.91	1.90
	1303.0	1.91	1.89
pH_B	419.5	1.78	2.23
	419.7	1.78	2.25
	418.4	1.78	2.25
pH_C	608.0	1.87	1.61
	589.2	1.87	1.58
	587.0	1.87	1.48
pH_D	460.1	1.81	1.71
	552.2	1.86	1.70
	550.3	1.88	1.71
S_A	311.3	1.96	1.55
	307.4	1.96	1.58
	310.0	1.97	1.59
S_B	425.8	1.94	2.24
	404.6	1.94	2.24
	422.8	1.94	2.21
S_C	431.1	1.95	1.86
	395.9	1.97	1.87
	394.2	1.97	1.84
S_D	325.6	1.97	1.94
	331.3	1.98	1.95
	328.0	1.98	1.94

---

March 10, 2011
I'm continuing with RNA extraction and quantification.

Methods (RNA Extraction, RNA Quantification)
The frozen samples were removed, thawed and vortexed. 200 μL chloroform was added to each the tube. The tube was vortexed for 30 seconds, then incubated at room temperature for 5 minutes, and spun in a refrigerated centrifuge at 12,000 g for 15 minutes. As much of the aqueous layer was pipetted into a sterile, labeled microcentrifuge tube without disturbing any of the other layers. 500 μL isopropanol was added to the tube containing the aqueous layer. The tube was inverted several times until the mixture was no longer lumpy. The tube was held at room temperature for 10 minutes. The tube was placed in a refrigerated microcentrifuge with the hinge facing up, then centrifuged at 12,000 g for 8 minutes. The supernatant was removed and discarded. 1 mL 75% ethanol was added to the tube and vortexed to dislodge the RNA pellet inside. The tube was spun at 8000 g for 5 minutes in a refrigerated centrifuge. The supernatant was discarded. The tube was centrifuged for 15 seconds, as much supernatant as could be extracted was discarded. The tube was left open to dry under the fume hood for 5 minutes. 100 μL 0.1% DEPC-H2O was added to the pellet. The contents were mixed by pipetting up and down. The tube was capped and placed in a 54°C water bath for 5 minutes. The tube was removed from heat and transferred to an ice bucket.


2 μL of 0.1% DEPC-H2O was placed onto the pedestal and lowering arm of a nanodrop spectrophotometer. The arm was lowered and calibrated to zero. The pedestal and the arm were gently cleaned using a Kimwipe. 2 μL of RNA sample was pipetted onto the pedestal. The arm was lowered and A260/A/280 and A260/A230, and concentration in ng/μL were calculated by the spectrophotometer and recorded. The samples were stored at -80°C. Expected A260/A280: 1.8-2.0. Expected A260/A230: 1.5-2.0.


Results

	Concentration (ng/uL)	A260/A280	A260/A230
0_A	1782.1	2.01	2.26
0_B	1723.5	2.02	2.22
0_C	1084.2	1.96	2.35
0_D	1598.4	2.02	2.28
pH_A	322.1	2.02	1.65
pH_B	367.3	1.99	2.32
pH_C	360.5	2.04	2.16
pH_D	335.5	2.01	2.09
S_A	2906.4	1.84	2.34
S_B	1325.4	1.93	2.34
S_C	2934.4	1.83	2.10
S_D	368.2	1.83	2.15
	2150.6	1.94	2.24
	1244.0	1.93	2.31

Looking at the nanodrop spec data for samples S_C and S_D, I thought that there may be a chance I didn't wipe the pedestal down well enough (A260/A280 and A260/A230 ratios were very similar). So I quantified it two more times. All three concentrations are very different. Overall, looking at all of the Absorption ratios, my RNA samples seem to have a low level of impurities. I'm not sure if I should DNase.

---

March 9, 2011
Today, I'll be performing TriReagent extractions.

Methods
I am working with three O. nerka treatment groups: untreated juveniles, acid-shocked juveniles, and early-arriving, pre-senescent adults. 500 μL of TriReagent was added to a 1.5 mL microcentrifuge tube containing one juvenile sockeye salmon head (0.05-0.1 g). A sterile plastic pestle was used to mash the tissue. The sample was vortexed at medium speed. 500 μL of TriReagent was added to the tube, and another plastic plunger was used to finish homogenizing the sample. The tube was then vortexed. The samples were store at -80°C.

---

March 7, 2011
Open-ocean salmon are pretty difficult to preserve since there isn't any efficient way to flash freeze them for long enough periods of time. Consequently, there aren't any quality samples available through other labs. There are some interesting questions to ask with the samples that we do have, however.

We have untreated and acid-shocked juveniles, as well as pre- and post- spawning adults. I would like to see what the acid treatment does to telomerase activity. Untreated juvenile telomerase activity should give me a baseline level for what I would consider as "normal" telomerase expression. Then, by comparing the normal expression to acid-shocked and early- and late-arriving spawning salmon, I may be able to see some significant difference in telomerease gene expression. So the question is: Does increased acidity increase telomerase expression? The idea is that high telomerase expression is a potential proxy for biological aging. Increased levels in acid-shocked juveniles and spawning salmon may indicate that decreased pH correlates to faster aging.

I've seen the acid-shocked box in the -80 freezer. I will need help in identifying the untreated and spawning salmon.
Untreated juveniles
Acid-shocked juveniles
Early- or late-arriving spawning salmon

---

March 2, 2011
Methods
Agarose Gel, Gel Electrophoresis
50mL of modified 1X Tris-Acetate-EDTA was mixed with 0.40g Agarose (0.8% Agarose solution). The flask was weighed (179.19g) and heated for 90 seconds in a microwave. The heated mixture was swirled to ensure complete dissolution of Agarose. Deionized water was added to the flask to bring the mass back up (182.00g). It was left to cool at room temperature for 10 minutes. 5.0 μL Ethidium Bromide was added to the mixture. It was poured into a gel mold with an 8-well comb (1.5mm wells) and allowed to set for 30 minutes. The gel was placed in a gel box and covered with TAE. 5 μL Hyper I Ladder, each 20-μL sample, and controls were loaded into separate wells and the gel was run at 100V for 25 minutes. The gel was removed, then viewed and photographed under UV light.

Ladder - LPS T - POLY CTRL - POLY T - Ctrl 1 - Ctrl 2


Figure 1: Image of gel with LPS Treatment Highlighted.


Figure 2: Image of gel at higher exposure showing a band near 200bp for Poly:IC Control.

LPS Treatment (in the lane 2, next to the ladder) included samples 25, 26, 27, 28, 30, and 32. Sample 28 was the one that had copied a large product in the gel I ran last week. Lane 3 had pooled Poly:IC controls, including Sample 36, which showed a 200bp band last week. I never used any samples above 36, which include all of the Poly:IC treatments. So there is some level of consistency in my results. But I still don't know what's going on. I could qPCR to see how well the primer is working or I could cut the bands and sequence them to see what they are. I think the funny banding patterns have something to do with the treatments. Unfortunately, there are no untreated samples I could use for control. I think all of the samples went through the at least the pesticide cocktail.

---

February 28, 2011
In the interest of time, I might consider just using adult brain, liver, or fin clip samples from O. nerka collected at sea, perform an assay on Telomerase gene expression, and leave the comparison to a future study.

I also found out what treatments were administered to the individuals.
1, 4, and 8 were mock controls. 12 and 16 were mock treatments. 20 and 24 were LPS controls. 28 and 32 were LPS treatments. 36 was a Poly:IC control.

28 was the one that showed two bands. If I had pooled the DNA instead of running them individually, I probably would have seen much stronger amplification of my target 202-bp product. I'll test that by running the assay again. The goal is to try to figure out why there is a second band on sample 28 and to get stronger bands for the 202-bp Tert gene.

Methods

	Volume (μL) per reaction	Master Mix Total Volume (μL) for 10 reactions
cDNA Sample	4	---
2X Apex	10	100
Forward Primer (10 μM)	0.6	6
Reverse Primer (10 μM)	0.6	6
PCR H2O	4.8	48
Total Volume	20	16 μL Master Mix per reaction

I pooled cDNA samples that were previously DNased, just to be sure. DNA was also pooled by treatment. Only 3 treatments had two or more cDNA samples to pool.

LPS Treatment: 25, 26, 27, 28, 30, 32
Poly:IC Control: 33, 36
Poly:IC Treatment: 41, 42, 43, 45

I also ran two negative controls using PCR water instead of cDNA.

---

February 23, 2011
Methods
Agarose Gel, Gel Electrophoresis
75mL of modified 1X Tris-Acetate-EDTA was mixed with 0.60g Agarose and heated for two minutes in a microwave. The heated mixture was swirled to ensure complete dissolution of Agarose. It was left to cool at room temperature for 10 minutes. 7.5 μL Ethidium Bromide was added to the mixture. It was poured into a gel mold with a 20-well comb and allowed to set for 30 minutes. The gel was placed in a gel box and covered with TAE. A ladder, samples, and controls were loaded into the wells and the gel was run at 107V for 25 minutes. The gel was removed, then viewed and photographed under UV light.

The ladder used was 5 μL HyperLadder I

Arrangement of the samples:

Lane 1

Lane 2

Lane 3

Lane 4

Lane 5

Lane 6

Lane 7

Lane 8

Lane 9

Lane 10

Lane 11

Lane 12

Lane 13

Ladder

1

4

8

12

16

20

24

28

32

36

Control 1

Control 2

Results

Figure 1: Gel viewed under UV light. Bands of the ladder visible in this picture, from top to bottom, are 3000bp, 2500bp, 2000bp, 1500bp, 400bp, and 200bp.

DNA amplification was present at 200bp in samples 4, 12, 24, 28, and 36. The negative controls were clean. I am unaware if the treatments administered to any of the individuals had anything to do with the results. The primer I'm using results in a 202bp product, so this O. mykiss Tert primer does seem to work for amplifying the O. nerka Tert gene, but I'd like to see amplification in all of the samples.

From here, I'd like to see if there are differences in O. nerka Tert expression between adults collected at sea and salmon that are ready to spawn. If possible, I'd like to use brain or liver samples, but I think fin clips would work too. Livers were used in the samples I used to test my primers.

---

February 16, 2011
There are 45 Oncorynchus nerka cDNA samples from the Autumn 2010 Fish 411 class that were preserved from an even earlier experiment. I believe this cDNA has previously been DNased. I'll test my primers via PCR and gel electrophoresis using 10 samples of the preserved cDNA and run two negative controls.

Methods

	Volume (μL) per reaction	Master Mix Total Volume (μL) for 15 reactions
cDNA Sample	4	---
2X Apex	10	150
Forward Primer (10 μM)	0.6	9
Reverse Primer (10 μM)	0.6	9
PCR H2O	4.8	72
Total Volume	20	16 μL Master Mix per reaction

cDNA Samples: 1, 4, 8, 12, 16, 20, 24, 28, 32, 36, -Ctrl 1, -Ctrl 2

PCR Cycles
95°C: 10 minutes

95°C: 15 seconds
55°C: 15 seconds
72°C: 30 seconds
(repeat x39)

72°C: 10 minutes
4°C: hold

---

February 14, 2011
http://www.springerlink.com/content/512txw2pkjn9dlwt/
Primers (Om_Tert_F and Om_Tert_R) were diluted to working concentrations (10 μM). I'll use 2x Apex Red for my master mix.

---

February 2, 2011
Primers ordered

---

January 26, 2011

Notes from scientific papers I've read can be found here:
https://docs.google.com/document/d/1sZwTjwQzgGuw1noU7buTqDQ59GyvTXZYmADmMLPzyYQ/edit?hl=en&pli=1&authkey=CMKYxdEF#

---

January 24, 2011
Oncorynchus mykiss Telomerase reverse transcriptase (Tert) mRNA (accession number HM852030) shows close homology to Oncorynchus nerka, my species of interest. Primer design using Primer3.

Primer	Sequence	Number of Bases	%Guanine, Cytosine	Melting Temperature	Product Size
Forward	CTTCCTCAAGACCCTCATGG	20	55	59.65 °C	202 bases
Reverse	AGCGTAGCTGGCGTAGTTGT	20	55	60.10 °C	202 bases

Full Sequence (248 bases)
GCAGCA CAGACC TTCCTC AAGACC CTCATG GCGGGG GTACCA CGGTAC GGGTGT GTGGTG ACCCCC AAAGTG GCTGTT AACTTC
CCTTTG GGTGAG TGGGGG TCCTGT CCTGCT GGGGTA CGCCTG CTGCCT TTACAC TGTCTG TTCCCC TGGTGT GGACTA CTGCTG
AATACA CACACC CTGGAC GTCTAC AACAAC TACGCC AGCTAC GCTGGC CTATCA CTGCGC TACAGC CTTAAC TCTTGG GA

---

January 20, 2011
http://www.ncbi.nlm.nih.gov/gene/796551 (tert GENE)

O. Mykiss tert http://goo.gl/2FYdT




Storer Favorite Gene Page

---

October 5, 2010

Summary
RNA was extracted from a sockeye salmon tissue sample. A Bradford Assay was prepared from a second sample of the same fish to measure what?- storercg. The absorbance at 595 nm the assay was then measured.

Materials and Methods
The individual juvenile sockeye salmon from which tissue was extracted was administered pH treatment D.

RNA Extraction
500 μL of TriReagent was added to a 1.5 mL microcentrifuge tube containing one sample of sockeye salmon tissue. A sterile plastic pestle was used to mash the tissue. The sample was vortexed at medium speed, and another sterile pestle was used to finish homogenizing the sample. 500 μL of TriReagent was added to the tube and vortexed again. The sample was stored at -80°C.

Protein Extraction and Bradford Assay
500 μL of CellLytic MT solution was added to a 15 mg sample of sockeye salmon tissue in a 1.5 mL microcentrifuge tube. A sterile plastic pestle was used to mash the sample. The contents of the tube were mixed by inverting the capped tube several times. The contents of the tube were placed in a refrigerated centrifuge for 10 minutes at about 7,000 RPM. The supernatant was extracted from the centrifuged mixture and placed in a labeled, sterile micro snap-cap tube.

15 μL of the protein sample (supernatant) was pipetted into another labeled, sterile micro snap-cap tube. (The rest of the protein sample was stored at -20°C.) 15 μL of deionized water was pipetted into the tube and mixed by pipetting the contents several times. 1.5 mL of Bradford reagent was added to the tube. In a separate labeled, sterile micro snap-cap tube, 30 μL of deionized water and 1.5 mL of Bradford reagent was added. The tubes were both incubated at room temperature for 10 minutes. After 10 minutes, the contents of each tube was placed into one of two separate, sterile disposable cuvettes.

The cuvette containing only DI water and Bradford reagent was used as a blank to calibrate the spectrophotometer at 595 nm. After calibrating the spectrophotometer, the cuvette containing the extracted salmon protein was placed in the machine, and its absorbance was recorded. The sample was taken out, mixed by pipetting the contents, and then the absorbance was measured a second time. The absorbance readings were averaged. The average absorbance was used to calculate the protein concentration using the concentration curve, which is given by y=mx+b, where m=1013.9, x is the average absorbance, and b=0.

Results
First absorbance reading at 595 nm: 0.177
Second absorbance reading at 595 nm: 0.173
Average absorbance: 0.175
Protein concentration (y): 177.4 include units - storercg

Conclusions
The RNA extracted from first sample contains the transcriptome of the individual. This is a very sweeping statement, DNA is actually considered to be what carries the genetic information of an individual, RNA only represents a snap shot of the genetic material being actively expressed. - storercg The next step will be to research genes of interest and design a primer that would allow for amplification of that gene via PCR. Good! - storercg What about the protein extraction? - storercg

Reflection
The purpose of this lab was to become acquainted with one of the essential techniques in physiology: RNA/DNA - storercgextraction to use in PCR. The other technique learned was how to calculate protein concentration of sample tissue using the Bradford Assay technique. RNA/DNA - storercgextraction is used to look at genetic sequences that are helpful in understanding organisms at the molecular level. Knowing protein concentrations can be useful as a proxy for knowing how the environment of a certain individual affects its behavior. For example, protein concentrations can be used to determine whether or not an individual is stressed by something in its environment. By first knowing what various proteins do, the presence or absence of specific proteins, such as heat-shock protein, allows scientists to ask more questions like "Why was there high production of heat-shock protein in this individual?" Excellent! - storercg Oct 14, 2010

Genes of interest
UI14551: Growth Hormone Gene
X91408: Gonadotropin Releasing Hormone
X67307: Metallothionein Promoter
Where are your genes of interest?- storercg Please post them in your lab notebook.

---

October 12, 2010

Summary
Protein stock isolated last week was prepared to run on SDS-PAGE gel. RNA was isolated and purified from RNA tissue stock from last week.

Materials and Methods
SDS-PAGE
Frozen protein stock that was prepared last week was thawed and mixed by inverting the contents of the capped centrifuge tube. 15 μL of protein stock was pipetted into a sterile, labeled 1.5 mL screw-cap tube. 15 μL of 2X reducing sample buffer was pipetted into the screw-cap tube. The protein stock was placed back in the freezer at -20°C. The mixture in the screw-cap tube was mixed by gently flicking the tube. It was spun in a centrifuge at maximum speed for 10 seconds to move all of the contents to the bottom of the tube. The tube was placed in boiling water for 5 minutes. The tube was taken out of boiling water and was centrifuged at maximum speed for 1 minute. The sample was loaded into one well of SDS-PAGE gel (Well #3, Gel #2) using flexible pipette tips. The gel was run at 150 V for 45 minutes. The gel was unloaded and placed into a tray. Coomasie Blue stain was added to cover the gel and placed on a rocking machine for 5 minutes. Coomasie Blue was poured back into the original container and the gel was rinsed with 10% acetic acid. The gel was covered with acetic acid and placed back on the rocking machine for about 5 minutes. The 10% acetic acid was changed about ever 5 minutes. Pictures of the completed gel were taken and posted on the discussion board.

RNA Extraction
The frozen tissue digested and frozen last week was thawed and incubated at room temperature for 5 minutes. 200 μL chloroform was added to the tube containing the sample. The tube was vortexed for 30 seconds, then incubated at room temperature for 5 minutes, and spun in a refrigerated centrifuge at 14,000 g for 15 minutes. As much of the aqueous layer was pipetted into a sterile, labeled microcentrifuge tube without disturbing any of the other layers. 500 μL isopropanol was added to the tube containing the aqueous layer. The tube was inverted several times until the mixture was no longer lumpy. The tube was held at room temperature for 10 minutes. The tube was placed in a refrigerated microcentrifuge with the hinge facing up, then centrifuged at 13,200 g for 8 minutes. The supernatant was removed and discarded. 1 mL 75% ethanol was added to the tube and vortexed to dislodge the RNA pellet inside. The tube was spun at 7500 g for 5 minutes in a refrigerated centrifuge. The supernatant was discarded. The tube was centrifuged for 15 seconds, as much supernatant as could be extracted was discarded. The tube was left open to dry under the fume hood for 3 minutes. 100 μL 0.1% DEPC-H2O was added to the pellet. The contents were mixed by pipetting up and down. The tube was capped and placed in a 54°C water bath for 5 minutes. The tube was removed from heat and transferred to an ice bucket.

RNA Quantification
2 μL of 0.1% DEPC-H2O was placed onto the pedestal and lowering arm of a nanodrop spectrophotometer. The arm was lowered and calibrated to zero. The pedestal and the arm were gently cleaned using a Kimwipe. 2 μL of RNA sample was pipetted onto the pedestal. The arm was lowered and A260, A260/A/280, A260/A230, and concentration in ng/μL were calculated by the spectrophotometer and recorded. The samples were stored at -80°C.

Results
The picture of the completed, stained gel revealed several bands. Not all of the bands were distinct or identifiable with the ladder used.



RNA concentration: 1192.3 ng/μL
A260/A280: 1.88
A260/A230: 2.40

Conclusions
Bands on the gel that correspond to known bands on the ladder were Phosphorylase, BSA, Glutamate Dehydrogenase, Alcohol Dehydrogenase, Lysozyme, Aprotinin, and Insulin/B Chain (http://www.dbe.uns.ac.rs/PDF/fiziologija/seeblueplus%20marker.pdf).

I yielded a very high RNA concentration. By the A260/A280 and A260/A230 ratios, the RNA that was isolated is clean (from Lab 2 handout). The expected ranges were between 1.8-2.0 and 1.5-2.0, respectively. Knowing that the RNA isolated has minimal contamination, I can proceed with primer design and PCR.

Reflection
The purpose of the lab was to test whether certain proteins were present in the individuals that were treated and sampled. Knowing that my juvenile sockeye salmon sample was administered a pH treatment (treatment D), I can now look at what each of the proteins does to help determine the possible environmental influences this individual was living with. Isolating and testing my RNA sample was to determine whether or not I could proceed with pure RNA for PCR. The Invitrogen seeblueplus handout lists several buffer systems, all of which have differing protein lengths that result from electrophoresis. It's unclear which buffer was used and so I have not determined the possible protein lengths.

---

October 19, 2010

Summary
Reverse Transcriptase was used to convert the RNA we purified and quantified last week into cDNA. That cDNA was prepared for PCR. Agarose gel was prepared to run the PCR product through gel electrophoresis. The primers used were O. nerka heat-shock protein HSC71.

Materials and Methods
Reverse Transcription
Purified RNA from last week was removed from the freezer, thawed, and mixed by inverting the closed tube of RNA several times. 5 μL of RNA extract, 1 μL oligo dT, and 4 μL nuclease-free water were combined in a sterile, labeled 0.5 mL PCR test tube. The mixture was pooled by centrifugation, then incubated at 70°C for 5 minutes in a thermocycler. After incubation, the PCR tube was transferred to ice. 5 μL of M-MLV 5X Reaction Buffer, 5 μL dNTPs, 1 μL M-MLV RT, and 4 μL nuclease-free water was added to the mixture. The mixture was centrifuged to pool all of the liquid at the bottom. The mixture was incubated at 42°C for 60 minutes. The temperature was then raised to 70°C for 3 minutes. The tube was then stored in ice.

Polymerase Chain Reaction
A master mix of primers was created by pipetting 250 μL GoTaq(R) Green Master Mix (2X), 15 μL HSC71 forward primer (10 μM), 15 μL HSC71 reverse primer (10 μM), and 108 μL nuclease-free water into a sterile, labeled 1.5 mL snap-cap tube. 48 μL master mix was pipetted into each of four sterile, labeled 0.5 mL PCR tubes. In tubes 1 and 2, a 2 μL aliquot of cDNA (from the "Reverse Transcription" procedure) was added. In tubes 3 and 4, 2 μL nuclease-free water was added. The tubes were capped, tapped lightly to mix the contents, and centrifuged for about 10 seconds to pool the liquid at the bottom. The tubes were placed in a thermocycler for PCR.

Step Temperature Duration Cycles
Initial Denaturing 95°C 5 minutes 1

Denaturing 95°C 30 seconds 40
Annealing 55°C 30 seconds 40
Extension 72°C 30 seconds 40

Final Extension 72°C 3 minutes 1

Storage 4°C

Agarose Gel
Two gels were made, both with the same procedure. 2 g agarose and 150 mL 1X TAE were combined in a 1 L erlenmeyer flask. The solution was microwaved for a total of 2 minutes, 40 seconds: every 20 seconds, the flask was removed from the microwave and the contents were swirled. The solution was cooled for less than 2 minutes at room temperature, and 12 μL ethidium bromide was added. The solution was swirled and poured into a gel tray. Two gel combs were set in the gel to create wells. After hardening, the gels were wrapped in plastic and stored in a refrigerator.

Results
(forthcoming)

Conclusions
(forthcoming)

Reflection
(forthcoming)

---

October 26, 2010

Summary
cDNA that we worked on purifying over the last few weeks was run through agarose gel that was created last week. A different sample of sockeye DNA was diluted and fixed to a nylon membrane via cytosine methylation dot blotting.

Materials and Methods
Gel Electrophoresis
The gels made last week were removed from the refrigerator and placed in a gel box. The gel box was filled with 1X TAE buffer to fully cover the wells of the gel. The combs were removed from the gel to expose the wells. 7 μL of HyperLadder 1 ladder was loaded into lane 1 of both rows. 25 μL of my PCR products were placed in four different wells. My samples were placed in the bottom row of Gel 1. Sample A was placed in Gel 1, well 10. Sample B was placed in Gel 1, well 11. Sample C was placed in Gel 1, well 12. Sample D was placed in Gel 1, well 13. (Samples C and D were negative controls). The gels were covered and run at 100 V for 55 minutes, 150 V for 9 minutes, and 85 V for 20 minutes. A picture of the gel was taken under UV light.

Cytosine Methylation Dot Blot
The DNA I used was labeled "Sockeye 2," a negative control. Five sterile 1.5 mL snap-cap tubes were labeled 1-5 representing the the different dilutions of my Sockeye 2 sample. The original concentration of Sockeye 2 sample DNA was 50 ng/μL. Each of the tubes was spun down after making the dilutions.

Dilution/Tube No. [Target] μL H2O μL 20X SSC μL Sockeye 2 DNA Sample
1 0.8 ng/μL 124 60 16
2 0.4 ng/μL 132 60 8
3 0.2 ng/μL 136 60 4
4 0.1 ng/μL 138 60 2
5 0.05 ng/μL 139 60 1

Nylon membrane was cut to fit 72 wells. The nylon membrane was covered in 6X SSC for 10 minutes. Filter paper was cut to the same size as the nylon membrane and also soaked in 6X SSC. The membrane was placed on top of the filter paper on top of the well box. 500 μL 6X SSC was pipetted into each well. A vacuum was applied to the manifold assembly. Meanwhile, the diluted DNA samples were placed in boiling water for 10 minutes, then transferred to ice for 5 minutes. The DNA was spun down to pool the liquid at the bottom and placed back on ice. The entire sample of diluted DNA was placed in a separate well. Dilution 1 was placed in well G7. Dilution 2 was placed in well G8. Dilution 3 was placed in well H7. Dilution 4 was placed in well H8. Dilution 5 was placed in well H9. A vacuum was applied to the assembled manifold. Filter paper was cut to the same size as the nylon membrane and soaked in denaturation buffer. After the samples had filtered through, the manifold was disassembled and the nylon membrane was placed under the filter paper that was previously soaked in denaturation buffer for 10 minutes. The nylon membrane was then placed for 5 minutes under different paper that was pre-soaked in a second denaturation buffer. The membranes were placed on dry filter and under the fume hood to dry. The dryed nylon membrane was wrapped loosely in plastic wrap and placed DNA-side-down on the UV transluminator for 2 minutes to fix the DNA in place.

Results
The gel shows that there was some PCR product, indicated by a very bright band at around 200 base pairs. This result was consistent with Sample A and Sample B PCR products from last week. Sample C and Sample D, the negative controls, do not show any significant visible bands (there is some primer dimer at the bottom). No other bands are visible. Other samples that were loaded show various other bands of DNA. Most of the bands that are visible seem to be between 200 or 400 base pairs. There are a few PCR products that are about 1000 base pairs.

Western Breeze (R) Chromogenic Immunodetection was not performed on the DNA that was fixed to the nylon membrane.

Conclusions
There was some PCR product at about 200 base pairs, meaning that last week's PCR was successful.

Reflection
The purpose of this lab was to see if last week's PCR was successful. This lab was also set up to learn about Methylated Cytosine Dot Blotting. Now that I have confirmed DNA present in my stock DNA, I can proceed with using the primer I designed (Metallothionein Promoter) on my DNA.

---

November 2, 2010

Summary
Dot blot samples from last week were developed by Western Breeze (R) Chromogenic Immunodetection. cDNA that we had isolated (O. nerka, pH treatment D) was prepared for qPCR.

Materials and Methods
Dot Blot/Immunodetection
Nylon membrane (to which DNA samples were fixed last week) was covered/washed with various solutions in a covered plastic dish. Each wash had a specific incubation period during which the dish was placed on a rocking machine/rotary shaker at about 1 revolution per second. Before each new wash, the previous wash solution was discarded. The first wash was 10 mL Blocking Solution for 30 minutes at about 1 revolution per second. The second wash was 20 mL water for 5 minutes. The third was another 20 mL of water for 5 minutes. The fourth wash was in 10 mL Primary Antibody Solution for 1 hour. The fifth through eighth washes were in 20 mL TBS-T for 2 minutes each. The ninth wash was with 10 mL Secondary Antibody Solution for 30 minutes. The tenth through thirteenth washes were with 20 mL TBS-T for 2 minutes each. The fourteenth through sixteenth washes were in 20 mL water for 2 minutes each. The seventeenth wash was in 5 mL Chromogenic Substrate until color was visible on the membrane. The final three washes were in 20 mL water for 2 minutes each. The nylon membrane was removed from the plastic dish and placed on top of a clean piece of filter paper.

qPCR
O. nerka Metallothionein Promoter was chosen as the primer for this qPCR. The forward primer was 29.4 nM. 294 μL nuclease-free water was added to it to make it 100 μM. The reverse primer was 45.5 nM. 455 μL nuclease-free water was added to it to make it 100 μM. The primers were diluted even further for qPCR. In separate sterile snap-cap tubes (one for forward primer, one for reverse primer), 10 μL of 100 μM primer was mixed with 90 μL nuclease-free water. Master Mix for seven 50-μL reactions was created in a sterile snap-cap tube. 175 μL 2X Immomix, 14 μL Syto-13 dye (50 μM), 17.5 μL Forward Primer (10 μM), 17.5 μL Reverse Primer (10 μM), and 112 μL nuclease-free water were combined to create the Master Mix. 48 μL of Master Mix were added to each of 6 wells of a sterile, labeled white qPCR plate. 2 μL O. nerka (pH treatment D) cDNA was added to wells 1 and 2. 2 μL nuclease-free water was added to wells 3 and 4. 2 μL O. nerka (pH treatment D) RNA was added to wells 5 and 6. The wells were capped and the contents were spun in a microcentrifuge to pool the liquid to the bottom. The contents were run in a qPCR machine and the C(t) data from qPCR were recorded.

Results
Picture of the Dot Blot


Picture of the qPCR graphs

---

Project Proposal
Fin clipping is a common practice in tagging or marking fishes. And while one study showed that there is no difference in survival rate between clipped and unclipped fishes (Vander Haegen et. al, 2005), it has also been shown that there is a slight increase in energy required to swim after an adipose fin has been clipped (Reimchen and Temple, 2004). Only a few studies have been published on the physiology of the adipose fin. None of them have studied the stress imposed on a fish at the cellular level and the susceptibility or sensitivity to secondary environmental stressors after clipping. Acute or chronic stress? Even with an almost even survival rate (Haegen et. al, 2005), something may be going on at the cellular level. Interesting topic - storercg
The proposed study would focus on isolating proteins, RNA, and DNA of sockeye salmon reared in the exact same conditions, only with or without adipose fin clippings. The first question we want to answer is Is there any stress caused by the fin clipping directly on the individual? Immediately after clipping or one week after clipping? That would be measured by measuring cortisol levels in fishes with and without clippings. The next questions deal with environmental stressors. Is there increased or decreased fitness after clipping when exposed to higher pH, temperature, and/or pathogens? Sensitivity to environmental stressors under isolated pH, temperature, pathogens, and a mix between every combination of these would be measured by looking at expression of immune response genes, methylation, and enzyme activity. Specifically, we’d be looking at CRH and ACTH expression and Cyt P450 proteins and dot blotting DNA to view methylation differences in clipped and unclipped, treated and untreated individuals.
It might take some time to do pH, temperature, and pathogens, so I’d suggest temperature as the one secondary stressor to look at. Acclimating the fishes and fin clipping would take about a week. Purifying DNA would take another week. Dot blotting took three lab periods, but we could probably do it in two weeks if anybody was free to develop them after scheduled lab times. qPCR was much quicker. It only took a few hours, as most C(t) times were under 40 cycles. With 14 people, we’d have a good week to analyze our results and submit a paper in the 5 weeks we have left.

Cited References?

---

November 11, 2010
"Oyster Cloister" Project
Pacific Oysters (Crassostrea gigas) were collected from two sites on November 11, 2010. The first site was Belfair State Park, WA, considered to be an urbanized or polluted site, relative to University of Washington-owned Big Beef Creek, WA. Big Beef Creek is considered to be pristine. All oysters were taken home by Professor Roberts and will be transferred to holding tanks in UW FSH basement on Friday to acclimate over the weekend.

---

November 19, 2010
Oysters were to be administered four different treatments. The first treatment, a negative control, is just to sit in water for 72 hours. The second treatment is to treat the water with 6.5mg Copper Sulfate (CuSO4) for 72 hours. The third treatment is to add Vibrio tubiashii (Vt) to the water. The fourth treatment is to add 6.5mg CuSO4 to the water for 72 total hours. At hour 48, Vt. will be added for the final 24 hours. On November 16, 2010, all oysters were administered CuSO4 treatment. CuSO4 in water dissociates to form Cu(2+) ions. On November 18, 2010, Vibrio tubiashii was added to the aforementioned oyster treatments. 8 oysters per site were exposed to each treatment. 32 oysters from Belfair State Park and 32 oysters from Big Beef Creek were treated. In the interest of time, oysters from Belfair State Park will not be analyzed unless time permits. Each treatment was separated into two groups: A or B. Both groups were administered identical treatments, but A and B groups were done so that we could have replicates.

Water Treatment 1 - None (Negative Control) - 1A, 2A, 3A, 4A | 1B, 2B, 3B, 4B - where groups A and B were administered identical treatments, but were kept in different buckets.
Water Treatment 2 - CuSO4 - 1A, 2A, 3A, 4A | 1B, 2B, 3B, 4B - where groups A and B were administered identical treatments, but were kept in different buckets.
Water Treatment 3 - Vt - 1A, 2A, 3A, 4A | 1B, 2B, 3B, 4B - where groups A and B were administered identical treatments, but were kept in different buckets.
Water Treatment 4 - Cu + Vt - 1A, 2A, 3A, 4A | 1B, 2B, 3B, 4B - where groups A and B were administered identical treatments, but were kept in different buckets.

On November 19, 2010, all water treatments ceased, and the oysters were removed from the water and remained separated by site, by treatment, and by group A or B. 32 oysters, originally from Big Beef Creek, WA were shucked. Gill tissue, mantle tissue, and hemolymph was extracted from each oyster (except Control 4B and Cu+Vt 4A , which were shells that we did not know were only packed with sand from the beginning of the experiment). Each different tissue was placed in separate sterile, labeled 1.5-mL test tubes. We will perform tri-reagent RNA extractions from the gill tissue on Monday. The goal ist to extract RNA, reverse transcribe it into cDNA, and then perform qPCR on the cDNA (our desired experiment), RNA (a control for DNA carryover from tri-reagent extraction), and nuclease-free water (a control for contamination in any other qPCR reagents). The gene I'm looking at is C. gigas Metallothionein IV.

Metallothionein IV gene, exons 1-4 for Crassostrea gigas is 2196 base pairs long (Accession number AM265551;http://www.ncbi.nlm.nih.gov/nuccore/AM265551.1)

Primer	Sequence	Number of Bases	% Guanine, Cytosine	Melting Temperature
Forward	taaaggcaaagccaagtgct	20	45.00%	60.02°C
Reverse	ggtgcaccaaataagcgaat	20	45.00%	59.97°C

---

November 26, 2010
Snow days prevented anybody from performing tri-reagent extractions from our tissue samples.

---

November 29, 2010

Today's goal was to spec RNA extracts and figure out how much nuclease-free water to add in order to get a target concentration of 200ng/μL.

Sample	Concentration (ng/μL)	V(1) (RNA) (μL)	Water (μL)
1A	3599.6 ng/μL	27.78 μL	472.22 μL
2A	3590.2	27.85	472.15
3A	2521.5	39.6	460.4
4A	2355.7	42.45	457.54
1B	1907.9	52.41	447.58
2B	1733.0	57.7	442.3
3B	2757.3	36.27	463.73
4B	(no sample)	(no sample)	(no sample)
Cu1A	2275.6 ng/μL	43.94 μL	456.06 μL
Cu2A	3374.1	29.64	470.36
Cu3A	3682.3	27.16	472.84
Cu4A	3533.6	28.3	471.7
Cu1B	3474.5	28.78	471.22
Cu2B	3618.5	27.64	472.36
Cu3B	3646.1	27.43	472.57
Cu4B	3604.1	27.75	472.25
Vt1A	3525.9 ng/μL	28.36 μL	471.64 μL
Vt2A	3624.1	27.59	472.41
Vt3A	3487.0	28.68	471.32
Vt4A	3426.8	29.18	470.82
Vt1B	2860.6	34.96	465.04
Vt2B	2435.1	41.07	458.93
Vt3B	3571.1	28.0	471.0
Vt4B	2494.0	40.1	459.9
CuVt1A	1772.5 ng/μL	56.42 μL	443.58 μL
CuVt2A	3355.6	29.8	470.2
CuVt3A	3429.7	29.16	470.84
CuVt4A	(no sample)	(no sample)	(no sample)
CuVt1B	1500.3	66.65	433.35
CuVt2B	1919.5	52.1	447.9
CuVt3B	3685.1	27.14	472.86
CuVt4B	3613.8	27.67	472.33

---

November 30, 2010
We started making dilutions of our extracted RNA, but when we quantified to double-check our math, our concentrations were weaker by a factor of 100X. We were looking for 200 ng/μL, but we were getting on the order of 20 ng/μL. In the interest of time, we decided to DNase our RNA, then spec again. We used Turbo DNA-Free reagents and methods. These are the mass spec data after DNase.

Here are the concentrations

Sample Number	Control [RNA] (ng/µL)	Cu [RNA] (ng/µL)	Vt [RNA] (ng/µL)	Cu+Vt [RNA] (ng/µL)
1 A	769.9	812.7	1479.1	1226.0
2 A	1355.2	1304.7	1297.8	1403.1
3 A	930.7	1319.8	1649.6	1382.1
4 A	817.0	1764.3	1387.0	(no sample)
1 B	1119.8	940.8	863.1	885.5
2 B	594.2	1567.1	1454.5	1052.8
3 B	1514.8	1941.4	2214.9	1529.2
4 B	(no sample)	1524.1	1025.8 (not much sample is left but there's plenty of RNA in what we have)	1030.1

A260/A280 were between 1.88 and 2.02 for all of our samples.

---

December 1, 2010

qPCR Reagents

Reagent	Volume (µL)	[Final]	Volume needed for 68 reactions (µL)
Master Mix (2X Immomix)	12.5	1X	850
Syto-13 Dye (50µM)	1	2µM	68
Forward MT Primer	1.25	2.5µM	85
Reverse MT Primer	1.25	2.5µM	85
Ultra Pure H2O	7.0	N/A	476
cDNA	2.0µL/reaction

qPCR was set up using MM according to the recipe above.

---

December 11, 2010

Normalized fold/min data for Metallothionein IV are averaged on the linked Google doc.

ANOVA reveals that our means may be due to sampling error, and that there is no significant difference in any of the means of the four different treatments (P=0.09). It looks like something is going on, namely, that the presence of Vt has the ability to inhibit gene expression of MT(IV) in C. gigas. There is very little. By increasing the number of samples or increasing the amount of replicates, we probably would have seen a significant difference in the means between the four treatments.