Objective: Blast the sequence on NCBI to see if it matches any known sequences.
Results: found a connection to a bacteria (shown below)
Wednesday, June 24, 2015
===Sequencing information===Objective: Work with Geneious 5.6.7 basic addition to align sequencing data. Take Data from multiple PCRs sent out for sequencing cDNA and DNA
Results: Results from sequenced multiple pieces though still quite a few ambiguities. Included settings used in Geneious for reference. I will need to go over results with Dr. Roberts and Sam to interpret and possible redo alignment for better results. Tried multiple Cost Matrix with varied results so I was not sure if I was using the program correctly.
Wednesday, June 17, 2015
06/17/2015
Objective: Started cleaning up notebook go through and start adding in "Objective" and "Results" for each work day. Fill out any missing information. Decided to start using Blogger again because of user friendliness and to transfer into wiki. (http://genefish.wikispaces.com/Jonathan%27s+Notebook)
Results: Updated large portion of the posts and added comments and additional information. A good start to cleaning up the notebook need to sit down with Sam and make sure all necessary details are in place.
Thursday, June 4, 2015
06/04/2015
Objective: Run PCR products from 06/01/2015 on a gel to verify Luciferase and GFP primers were correct, and if primers were correct and bands are shown remove bands and send out for sequencing
Ran out PCR products from 06/01/2015 on gel
Lanes as seen in the picture,
1 Ladder (Hyper Ladder 1)
2 GFP 1 (P1)
3 GFP 2 (P2)
4 Control
5 Control
6 Blank
7 Blank
8 Luciferase 1 (R1)
9 Luciferase 2 (R2)
10 Control
11 Control
12 ladder (Hypper ladder 1)
| sr_ID |
Primer name |
Primer Sequence |
date ordered |
#bp |
GC% |
Organism |
Gene |
Gene Accession# |
location on reference |
pair w/sr_ID |
product size |
IDT # |
| 1604 |
Rr_46_65F |
CGGATGATAACTGGTCCGCA |
8/20/14 |
20 |
55 |
Renilla reniformis |
Luciferase |
M63501 |
46-65 |
1603 |
822 |
124903282 |
| 1603 |
Rr_887_868R |
TCAGGTGCATCTTCTTGCGA |
8/20/14 |
20 |
50 |
Renilla reniformis |
Luciferase |
M63501 |
887-868 |
1604 |
822 |
124903283 |
| 1602 |
Pg_1_PP6_53_72F |
CGGCAAAAGCTAGCGTTGAA |
8/18/14 |
20 |
50 |
Ptilosarcus gurneyi |
Ptilosarcus Green Fluorescent Protein (GFP) |
HV097611 |
53-72 |
1601 |
1054 |
124817505 |
| 1601 |
Pg_2_PP9_1107_1088R |
ACGTGCGGTCTCTTTATGCT |
8/18/14 |
20 |
50 |
Ptilosarcus gurneyi |
Ptilosarcus Green Fluorescent Protein (GFP) |
HV097611 |
1107-1088 |
1602 |
1054 |
124817506 |
Results: Lane 2 and 3 showed multiple bands none within anticipated length of 1054 but still removed brightest band in lane 3 in line with size "800" on the ladder. Lane 8 and 9 showed bright bands that were in line with the correct size of 822 removed both bands. All removed bands were sent purified and sent out for sequencing by Sam
Monday, June 1, 2015
06/01/2015
Objective: Start a pcr with both luciferase primers, and Green florescent Protein primers with DNA produced on 05/27. Used the same procedures and measurements for the PCR as 04/22/2015 though used different temperatures increasing the 72 degree step from 1 min to 3 min to account for the larger strand size in DNA . Prepared a gel for Wednesday using previous measurements from 5/18/2015.
PCR tubes
Green Florescent Protein PCR P1, P2 (Ptilosarcus gurneyi) template P3, P4 (Water Control)
Luciferase PCR R1, R2 (Renilla reniformes template) R3, R4 (Water Control)
Results: Completed PCR and will run out on prepared gel.
Wednesday, May 27, 2015
05/27/2015
Objective: Start DNA extraction on sample "night 2" an additional tissue sample taken during the manipulation experiment. DNA extraction preformed with E.Z.N.A. mollusk dna kit.
Methods: E.Z.N.A.® Mollusc DNA Protocol
Invertebrates preserved in formalin should be rinsed in xylene and then ethanol before processing. Note that results obtained with formalin-fixed tissues generally depend on age and size of specimen. Purified material is usually adequate for PCR amplification, but fresh or frozen samples should be used for Southern analyses.
Materials and Equipment to be Supplied by User: •
Microcentrifuge capable of at least 10,000 x g • Nuclease-free 1.5 mL or 2 mL microcentrifuge tubes • Water baths capable of 60°C and 70°C • Vortexer • 100% ethanol • Chloroform:isoamyl alcohol (24:1)
Before Starting: • Prepare buffers according to the instructions on Page 4 • Set water baths to 60°C and 70°C • Heat Elution Buffer to 70°C 1.
Homogenize tissue sample following one of the procedures below depending on the sample type. A. Arthropods
1. Pulverize no more than 50 mg of tissue in liquid nitrogen with a mortar and pestle. Note: If ceramic mortar and pestle are not available, homogenize the sample in the microcentrifuge tube using a disposable microtube pestle (Omega Bio-tek, Cat No. SSI-1015-39; Eppendorf, Cat No. 0030 120.973; VWR, Cat No. KT 749520- 0000).
2. Transfer the powder to a clean 1.5 mL microcentrifuge tube.
3. Proceed to Step 2 below. E.Z.N.A.® Mollusc DNA Kit Protocol
B. Molluscs (and other soft tissue invertebrates)
1. Pulverize no more than 30 mg tissue in liquid nitrogen with a mortar and pestle.
2. Transfer the powder to a clean 1.5 mL microcentrifuge tube. Note: If ceramic mortar and pestle are not available, homogenize the sample in the microcentrifuge tube using a disposable microtube pestle (Omega Bio-tek, Cat No. SSI-1015-39; Eppendorf, Cat No. 0030 120.973; VWR, Cat No. KT 749520-0000). Addition of a pinch of white quartz sand, -50 to 70 mesh (Sigma Chemical Co. Cat No. S9887) will help.
3. Proceed with Step 2 below.
Note: The amount of starting material depends on the sample and can be increased if acceptable results are obtained with the suggested 30 mg tissue. For easy-to-process specimens, the procedure may be scaled up and the buffer volumes used increased in proportion. In any event, use no more than 50 mg tissue per HiBind® DNA Mini Column as binding capacity (100 μg) may be exceeded. Meanwhile, difficult tissues may require starting with less than 30 mg tissue and doubling all volumes to ensure adequate lysis.
2. Add 350 μL ML1 Buffer and 25 μL Proteinase K Solution. Vortex to mix thoroughly.
3. Incubate at 60°C for a minimum of 30 minutes or until entire sample is solubilized. Note: Actual incubation time varies and depends on the elasticity of the tissue. Most samples require no more than 4 hours. Alternatively an overnight incubation at 37°C will produce adequate results.
4. Add 350 μL chloroform:isoamyl alcohol (24:1). Vortex to mix thoroughly.
5. Centrifuge 10,000 x g for 2 minutes at room temperature.
6. Transfer the upper aqueous phase to a clean 1.5 mL microcentrifuge tube. Avoid the milky interface containing contaminants and inhibitors. Note: This step will remove much of the polysaccharides and proteins from solution and improve spin-column performance downstream. If a small upper aqueous phase is present after centrifugation, add 200 μL ML1 Buffer and vortex to mix thoroughly. Repeat Step 5 (centrifugation) and Step 6 (transfer the upper aqueous phase).
7. Add one volume MBL Buffer and 10 μL RNase A. Vortex at maximum speed for 15 seconds. Note: For example, to 500 μL upper aqueous solution from Step 6, add 500 μL MBL Buffer.
8. Incubate at 70°C for 10 minutes.
9. Cool the sample to room temperature.
10. Add one volume 100% ethanol. Vortex at maximum speed for 15 seconds. Note: For example, to 500 μL upper aqueous solution from Step 6, add 500 μL 100% ethanol.
11. Insert a HiBind® DNA Mini Column into a 2 mL Collection Tube. Optional Protocol for Column Equilibration: 1. Add 100 µL 3M NaOH to the HiBind® DNA Mini Column. 2. Centrifuge at maximum speed for 60 seconds. 3. Discard the filtrate and reuse the collection tube.
12. Transfer 750 µL sample from Step 9 (including any precipitate that may have formed) to the HiBind® DNA Mini Column.
13. Centrifuge at 10,000 x g for 1 minute.
14. Discard the filtrate and reuse the collection tube.
15. Repeat Steps 12-14 until all of the sample has been applied to the HiBind® DNA Mini Column.
16. Discard the filtrate and the Collection Tube.
17. Insert the HiBind® DNA Mini Column into a new 2 mL Collection Tube.
18. Add 500 μL HBC Buffer. Note: HBC Buffer must be diluted with isopropanol before use. Please see Page 6 for instructions.
19. Centrifuge at 10,000 x g for 30 seconds.
20. Discard the filtrate and reuse the Collection Tube.
21. Add 700 μL DNA Wash Buffer. Note: DNA Wash Buffer must be diluted with 100% ethanol prior to use. Please refer to Page 4 or the bottle label for instructions. 22. Centrifuge at 10,000 x g for 1 minute.
23. Discard the filtrate and reuse the Collection Tube.
24. Repeat Steps 21-235 for a second DNA Wash Buffer wash step.
25. Centrifuge the empty HiBind® DNA Mini Column at maximum speed for 2 minutes to dry the membrane.
Note: It is critical to remove any trace of ethanol that may otherwise interfere with downstream applications.
26. Transfer the HiBind® DNA Mini Column to a nuclease-free 1.5 or 2 mL microcentrifuge tube (not provided).
27. Add 50-100 μL Elution Buffer (or sterile deionized water) preheated to 70°C. Note: Smaller elution volumes will increase DNA concentration but decrease yield. Elution volumes greater than 200 μL are not recommended.
28. Let sit at room temperature for 2 minutes.
29. Centrifuge at 10,000 x g for 1 minute.
30. Repeat Steps 27-29 for a second elution step. Note: Any combination of the following steps can be used to help increase DNA yield. • After adding the Elution Buffer, incubate the column for 5 minutes. • Increase the elution volume. • Repeat the elution step with fresh Elution Buffer (this may increase the yield, but decrease the concentration). • Repeat the elution step using the eluate from the first elution (this may increase yield while maintaining elution volume).
31. Store DNA at -20°C
Results: Successfully extracted DNA from tissues will now use PCR to replicate extraction product
Tuesday, May 26, 2015
05/26/2015
Objective: To run PCR product on a gel with same measurements and ladder as 05/18/2015, lane 1 and 2 loaded with P. gurneyi cDNA and lane 4 were controls loaded with H20 instead of template.
Results: Was expecting a product size of 822 but the gel shows around 200. additionally the bands are not well defined. No contamination seen in the gel will continue on 05/27/2015 with DNA extraction using tissue from the manipulation experiment using a partial sample to keep some for later experiment.
Wednesday, May 20, 2015
05/20/2015
Objective: Run PCR using all measurements and temperatures from 04/22/2015 and cDNA from 04/15/2015 (tube cdna1 written on side of pcr tube)
Results: Successfully ran the PCR will now proceed to run out on a gel.
Monday, May 18, 2015
05/18/2015
Objective: run PCR products in Friedman lab from 05/13/2015 on a gel
50ml 1x TBE
.5 grams agarose (1%)
5 ul athidium bromide
Gel run with hyper ladder I
Went over methods and materials with Sam all that's left is to hear back from Jake and will be able to finish up proposal
Results: verified that reagents had contamination. The experiment should of not shown any bands because template cDNA was replaced with H2O. On Wednesday will start with new reagents.
Gel
Wednesday, May 13, 2015
05/13/2015
Objective: Start a PCR to try to figure out contamination from 04/23.
Results: Ran PCR with H20 instead of template following all the measurements and running times of 04/22/2015. Will run gel on Monday with Sam and hopefully start another run with template to get ready for cloning.
Spent the remaining time working on finishing up the proposal. Sent off to Sam to verify methods and materials, and Jake to proof read. Updated intro, work cited, schedule, abstract.
Monday, May 11, 2015
05/11/2015
Worked on Proposal editing grammar finishing up methods, intro, and budget.
Thursday, April 23, 2015
04/23/2015
Objective: Run PCR product out on a gel to verify that the Luciferase cDNA was succesfully replicated
Results: Controls in lane 4 and 5 show contamination so will redo pcr with fresh ingredients (primers, h20, apex red etc)
PCR gel
Ladder: o'gene ruler 100bp #sm1143 lot 00189314 0.1 ug/ul
Cells
1 5 ul Ladder
2 23ul cDNA 1
3 23ul CDNA 2
4 23ul H20 1 (control)
5 23ul H20 2 (control)
Wednesday, April 22, 2015
04/22/2015
Objective: Ran pcr with template cDNA created from 4 rna sea pen rna samples on 04/15/2015 with Sam at the Roberts lab
used following temp. settings for the thermalcycler
Conventional PCR (2x Apex Red) [Cost per rxn ~ $0.52]
Single reaction (25uL) set up is listed below. Be sure to make a master mix volume that will accommodate all of your samples, two water (no template controls; NTC) samples, plus an extra 10% to accommodate pipetting errors. Distribute appropriate amount of master mix (volume of master mix + template = 25uL) to PCR tubes or PCR plate. Make sure all tubes/caps are tightly closed. Put in thermalcycler.
Reaction_Components
Volume
Final Concentration
2x Apex Red
12.5
1x
Forward Primer (10uM)
0.5
0.2uM
Reverse Primer (10uM)
0.5
0.2uM
Template
Up to 5uL
H2O (PCR grade)
variable
Use to bring reaction volume up to 25uL
Typical cycling paramaters (ask for help on using the thermal cycler):
95C - 10mins
40 cyles of:
95C - 15s
55C - 15s
72C - 1 mins (dependent on amplicon size; ~1000kb/min)
modified quantity measurements
Results: Sucessfully completed PCR will run out on gel to veirfy replication of cDNA.
Wednesday, April 15, 2015
04/15/2015
Objective: Convert RNA to cDNA with Sam at the Friedman lab used following reverse transcription protocol
Methods:
Reverse Transcription (Promega M-MLV: Cat#M1701; ) [Cost per sample ~$1.50]
A single reaction volume = 25uL. The volume of RNA, primer(s) and M-MLV RT used are variable and will be specific to your current experiment. The directions below apply to a reaction using 1ug of total RNA. You may need to make changes to accommodate your own conditions.
1. Use as much RNA as possible (up to 1ug); max volume of RNA = 17.75uL. Generally, identify the RNA sample with the lowest concentration and multiply by 17.75uL. Use this quantity (ug) of RNA for each and every sample.
2. Transfer calculated volume(s) of RNA to 0.5mL snap cap tubes or PCR plate. Adjust volumes of individual samples to 17.75uL with H2O.
3. Add appropriate amount of primer to sample. Use 0.25ug primer per 1ug of RNA in sample (= 0.5uL of Promega oligo dT Cat#C1101 in this example). Total volume (RNA + primers) should equal 18.25uL.
4. Heat samples at 70C for 5 min in thermocycler.
5. Place samples on ice IMMEDIATELY.
6. Make Master Mix:
PER RXN
5 uL 5x Buffer (M-MLV RT Buffer)
1.25 uL 10mM dNTPs (Promega Cat#U1511)
0.5 uL M-MLV RT per ug of RNA
Used 4uL of RNA (
1ul of rna from each of the original sea pen sample added to a single sample combining rna sp1-1 sp1-2 sp2-1 sp2-2)
7. Mix well.
8. Add 6.75uL of master mix to each reaction.
9. Mix well, but do not vortex.
10.Spot spin.
11.Incubate @ 42C for 1hr in thermalcycler for oligo dT primers OR @ 37C for random primers.
12.Heat inactivate @ 95C for 3 min.
13.Spot spin.
14.Store @ -20C.
Sucessfully converted RNA to cDNA next step is to replicate using PCR and verify on a gel.
Monday, December 22, 2014
12/22/2014
Objective: Have Sam run a gel using PCR product created from Sea Pen cDNA
PCR Gel
Gel run by sam
Final samples collected
1 daylight sample for 4 of the sea pens
1 dark sample for 4 of the pens
Final samples animals were euthanized by putting them into the -80C
Results:
e-mail:
"Unfortunately, your PCR didn't work, so there wasn't anything to cut out and purify. The issue this time is different than what you had before. In this instance, no distinct band was produced. For some reason, your sample is just a smear. The ladder run on the gel is the O'GeneRuler 100bp Ladder.
Looking at the size of the smear, and the fact that you have just a smear and no distinct band(s), suggests that what you have on the gel is RNA or straight cDNA. However, it's a LOT of RNA/cDNA (based on the intensity of the fluorescence)."
Inline image 2
| Inline image 2 |
Final samples collected
1 daylight sample for 4 of the sea pens
1 dark sample for 4 of the pens
Final samples animals were euthanized by putting them into the -80C
Tuesday, October 7, 2014
10/7/2014
Objective: Verify Sea Pen luciferase sequence was sucessfuly replicated using primerse based on Renilla Reniformes luciferase sequence acquired on Genebank.
PCR gel run today
Sea pen 1 and 2
1-1 lane 2 (note: Made sea pen luminescence before taking samples on both 1-1 (base cut) and 1-2 (top cut) )
1-2 lane 3 (note: Made sea pen luminescence before taking samples on both 1-1 1-2)
2-1 lane 4
2-2 lane 5
- lane 6
- lane 7
Bioline hyper ladder 1
Joined Dr. Roberts class lab and performed a conventional pcr (2x Apex Red)
6 tube 1-1,1-2,2-1,2-2,and 2 negative control tubes
master mix
2x apex red 12.5ul*6 =75ul
f primer 0.5ul*6 3ul
r primer 0.5ul*6 3ul
h20 6.5ul*6 39ul
=20ul per tube
template 5ul*6 30ul
95c-10 min
40 cycles of
95c 15s
50c 15s
72c 1min
Results: Replication was successful removed the brightest bands in lane 3 and 4 from the gel, and purified to prepare for sequencing. Samples were sent to "" (will add later)
Found out that the problem with the reverse transcription quantities was a pipetting error on the 10ul pipet i was using to much because of a mix up on the decimal place of the pipette
Introduced a spacer for the sea pens to keep them from touching each other testing it on the 5 gallon bucket . It splits the bucket in half reducing the area they are able to move around in without blocking flow or height the pen can extend Will see if it improves individual health of the sea pens.
With the automatic feeder I have noticed that the Pens have become much more consistent in activity so I believe I am set it up so that all of them can be sustained for a long period of time though more time will be needed to tell if this is true. It may be beneficial to create a paper just on my setup which could help others working with sea pens or related species.
Thursday, October 2, 2014
===10/2===
Objerctive: Convert RNA to cDNA using
Methods:
Reverse Transcription (Promega M-MLV: Cat#M1701; ) [Cost per sample ~$1.50]
A single reaction volume = 25uL. The volume of RNA, primer(s) and M-MLV RT used are variable and will be specific to your current experiment. The directions below apply to a reaction using 1ug of total RNA. You may need to make changes to accommodate your own conditions.
- Use as much RNA as possible (up to 1ug); max volume of RNA = 17.75uL. Generally, identify the RNA sample with the lowest concentration and multiply by 17.75uL. Use this quantity (ug) of RNA for each and every sample.
- Transfer calculated volume(s) of RNA to 0.5mL snap cap tubes or PCR plate. Adjust volumes of individual samples to 17.75uL with H2O.
- Add appropriate amount of primer to sample. Use 0.25ug primer per 1ug of RNA in sample (= 0.5uL of Promega oligo dT Cat#C1101 in this example). Total volume (RNA + primers) should equal 18.25uL.
- Heat samples at 70C for 5 min in thermocycler.
- Place samples on ice IMMEDIATELY.
- Make Master Mix:
PER RXN
5 uL 5x Buffer (M-MLV RT Buffer)
1.25 uL 10mM dNTPs (Promega Cat#U1511)
0.5 uL M-MLV RT per ug of RNA
7. Mix well.
8. Add 6.75uL of master mix to each reaction.
9. Mix well, but do not vortex.
10.Spot spin.
11.Incubate @ 42C for 1hr in thermalcycler for oligo dT primers OR @ 37C for random primers.
12.Heat inactivate @ 95C for 3 min.
13.Spot spin.
14.Store @ -20C.
3/17/2011 SJW
Starting RNA 1ug calculations
1-1 .99ul
1-2 2.31ul
2-1 1.13 ul
2-2 1.50 ul
Results: Procedure was going well until we reached the Master Mix solution. noticed that their was to much master mix left over so it is likely somewhere in the creation of the MM or pipetting the MM into the solution that an error was made. We still ran the entire protocol to see if anything was successful. Planning on running the PCR next week to verify that the primers that were ordered are valid.
Checked on the Sea pens today the changes to the peristaltic pump appeared to be successful everything was running correctly and the levels in the feeding bucket were the same as when I left yesterday. I am still considering removing the reverse flow on the pump into the bucket so the quantities of artemia being delivered are more consistent but will watch the sea pens to see if this makes a difference. I noticed that in each of the buckets with two sea pens that 1 sea pen is very inflated and looks healthy and the other does not so it is possible that they do not do well when in close quarters with each other possible because they are attacking each other when touching. I would like to take some tissue samples to verify that they in fact do have nematocysts though the I will have to look into if it would be visible just by looking through the microscope may need to find a way to fire them off which we had done in lab I will talk with Claire to see.
Wednesday, October 1, 2014
===10/1===
Peristaltic pump began leaking and flooding aquarium room today after some investigation I found the hose being used for the pump was breaking down. I replaced the hose but the next day it wound up in the rotar and destroyed the hose. After talking with Jon about possible solutions I made changes to the pump by adding more rotars to help hold everything in place and added wing nuts to secure everything. Regular rotation of the tubing will also help to reduce breakdown of the tubing (note: ask greg about ordering some peristaltic tubing to reduce issues.
Redesigned the feeding schedule to match tide fluctuations. Currently setup to feed for 3 hours at 6am which mirrors the sea pens normal feeding regiment better than 6 times a day for an hour. it is likely the pens were not getting enough access to the artemia.
I would like to look into the feeding habits of the sea pen and sea if I can get data to support the sea pens using luminescnece to attract artemia.
Saturday, September 27, 2014
Took samples from two of the sea pens removing pieces of fringes from the top and lower sections with scissors and a scalpol. Removed each of the pens from the water and placed on a tray. (notes: sea pens were very heavy and filled with water. once out of the water they started to leak the water reducing in size. With touch the pens started luminescing and started to shrivel making it difficult to take tissue from them. Best method was to quickly take tissue as soon as taken out of water so that the specimen did not have the chance to shrivel. One Pen was nicked on the inside of the stock and water rushed out. The Pens inflate themselves like a balloon increase greatly in volume in the water.) The sea pen recovered fully and it behavior in the tank stayed consistent with the others. it was able to inflate lower area below cut enabling it to grow not sure now it separates the area that was cut. Both pens seems to not be effected to harshly from the removal of tissue.
Sam went through everything for the RNA extraction going over step by step and teaching me the location and how to use all reagents and protocol. RNA extraction was a success numbers were successful
Made changes to the feeding schedule and setup. added a paralytic pump with a line pushing artemia into the tank and another pulling water into the 5 gallon food storage bucket. feeding every 6 hours for 1 hour.
Helped Jake with counts at Taylor shellfish and with maintenance in Olympia cleaning trays doing counts and transferring them to new cages.
An interest in bioluminescence original idea that it is a way to attract a predator to what is eating it is unlikely since what eats sea pens is not preyed upon by many thing that use visual ques. Plus the idea that sea pens light scares off what ever is trying to eat it is not supported since nudibranches, and starfish due not rely heavily on vision. After talking with Jake, and Professor Jensen my thought is that since artemia and other zooplankton are attracted to light it would make sense that a sea pen would light up to attract its prey.
Ordered more artemia from greg which has yielded much more artemia with each batch the past eggs were very old and it was very hard to keep consistent with the amount of artemia. When adding new artemia to the 5 gallon bucket 3 gallons are added and 1 gallon is added directly to the tank. The pump does not seem to be consistant with the amount of water it is moving back into the bucket so making some changes to equalize it may be nessecary though it is not enough yet to cause any issues. I had taken away the automatic feeder that was adding marine food flake to the aquarium and quickly noticed a decline in the sea pens. The note that they are detritivoreis supported I think they feed on both the artemia and the flake food that is made up of many diffrent types of marine ingredients.
Omega one Marine flakes:
Ingredients:
Whole Herring, Whole Salmon, Halibut, Black Cod, Seafood Mix (Krill, Rockfish, Shrimp, Squid, Clams, Salmon Eggs, and Octopus), Wheat Flour, Wheat Gluten, Fresh Kelp, Spirulina, Garlic, Lecithin, Astaxanthin, L-Ascorbyl-2-Phosphate (Source of Vitamin C), Natural and Artificial Colors, Vitamin A Acetate, Vitamin D3 Supplement, Vitamin E Supplement, Vitamin B12 Supplement, Riboflavin, Niacin, Pantothenic Acid, Folic Acid, Biotin, Inositol, Tocopherol (Preservative), Ethoxyquin (Preservative).
Guaranteed Analysis:
Crude protein (min) 43%, crude fat (min) 12%, crude fiber (max) 2%, moisture (max) 8.5%, ash (max) 8%, phosphorus (min) .5%, omega 3 (min) 2%, omega 6 (min) 1%.
9/25 First mortality occurred the upper portion (fringes) seemed to be disintegrating and the upper structure became very stiff and hard though the lower section seemed to still be alive which may be since this a colonial organism if one part dies the other may still be able to survive though it is likely without the ability to gather food would perish very quickly. The process happened within 2 days change was fairly rapid. (Note: the sea pen was in close proximity to other sea pens I am wondering if it they may attack each other when to close. Speaking with Greg he noted that in the wild they are not found close to one another so when touching it is possible that they use some defense to attack the others possibly using feeding structures (autozooids) with nematocysts.
Friday, August 8, 2014
===7/24-8/8===
Took two weeks to get an appointment with Dr. lewis but was able to and it was extremely helpful. She explained that I was looking at the biolumenescence reaction wrong or not fullly. I was looking to effect the main reaction but had the genetic information for luceferase. luceferase is likely produced consistently and stored. by manipulating the oxygen levels it would effect the initial reaction but would likely have no effect on the animals producing luceferase. So when it went to check if levels of luceferase had been manipulating it by changing the amount of oxygen it may effect the initial reaction and change the amount of light produced but since oxygen is not related to the production of luceferase when i checked genetic information it is likely their would be not change.
oxygen depletion and ocean acidification manipulation have many other effects on the animals and it would be hard to tell if that is actually the cause of the change in the luminescence or it is just causing extra stress and not directly effecting the animal. Dr. Al-noori brought up in class that and easy way to effect the reaction would be to effect the inter-cellular calcium storage where the calcium used to initiate the release of luceferase from storage would be. using a calcium kelator, or inter-cellular calcium channel blocker may be more efficient since it would not allow the release of the luceferase
One thing to look at may be to look into checking if luceferase is indeed constantly produced or if it is only produced when needed. it is likely since the animal uses this as a defensive function that it would make sure that the levels were never depleted by constantly producing luceferase. Doing a MRNA-CDNA-PCR on incoming specimens and then another after light production may answer this question and clear up any questions. Dr Lewis mentioned that in order the truly understand the entire genes responsible for luminescence I would need to look at the entire genome by using a microaray. i will need to find out more information it may be beneficial to locate the genome since I do not believe it has been done as of yet.
The enclosure is complete setup and put together as well as the artemia enclosure. I placed 7 2 gallon buckets in the bottom with sifted find sand donated by the fisheries department. A timer with light has been setup but will need to be worked with to make sure it is on the correct light cycle.
Greg will be acquiring up the animals this coming Saturday 8/9/2014 from Bainbridge island Crystal Springs pier were I will pick them up after the dive and transfer them to uw
Have not been able to complete history portion of the proposal since I have had to many questions on the process of the experiment and do not feel confident enough to finish it but now that I was able to talk to Dr. Lewis, and Al-noori i think I have a clearer idea on what to do.
For the manipulation experiment I am going to put the animals in both and oxygen depletion, calcium manipulation and ocean acidification environment and then measure the illuminations with a camera to see if their is any change. This will also give me the ability to check the genetics to see if the production of luceferase is being manipulated. or if I am able to get the entire genome I may be able to look at more of the reaction and see what all genes are responsible for the process. I will talk to Dr. Roberts to look into it.
I also saw some information that states that the sea pens may illuminate at night so I would like to find a way to recorded the live stream and be able to look over it to see if this is true not only will it be wonderful to see but could give me the ability to test their luminescence without having to stress the animal out by touching it but will not know till they arrive and are comfortable in the setup.
i need to really comb through the reaction and pull as much information I am going to look into a permanent dry erase board that I can have access to to write out the entire reaction and be able to study and develop. It seems to help me understand better when I can step back and look and the entire thing. The quarter is coming to and end so I will need to continue the research next quarter which will give me the chance to do all of my experiments and know the pens are being taken care of. Building access was figured out so I can come in and take care of the pens even on weekends.
Thursday, July 24, 2014
===7/24===
Had a meeting with Dr. Lewis from UW Bothell to help clarify some biology concepts about genetics and to help understand choosing primers and interpreting results of other researchers Genetic results. Choose primers so I can now order them for research.
Primer potentials
forward CGGCAAAAGCTAGCGTTGAA
reverse ACGTGCGGTCTCTTTATGCT
Wednesday, July 23, 2014
===7/21===
Got in contact with Greg and he agreed to collect the specimens for me.
Artemia are looking like the best bet for feeding the pens, Talked with Greg today and he recommended it as well. Since the tank is connected to a larger system I do not want to throw off anything plus the artemia are easy to work with.
Wednesday, July 23, 2014
7/22-7/23
Finished preparing everything for the aquarium, setup power-heads with adapter that constantly rotates to create a more "chaotic" current through out tank that Pens prefer.
Sanitized and Setup artemia hatching enclosure with airline tubing connected in to air outlet spoke with Greg and he gets specimens we will be able to order in Artemia eggs, Will hatch them regularly so that the Pens will have a consistant food source.
Found DNA sequence for luciferase and potential primers looking into how to choose primers to fit correctly.
Added more to Proposal should have more time after midterms are finished tomorrow to finish it up and have it signed by Dr. Roberts.
http://www.ncbi.nlm.nih.gov/nuccore/HV097611.1
Ptilosarcus sp. CSG-2001 green fluorescent protein (GFP) mRNA, complete cdsSequence ID: gb|AY015995.1|Length: 1094Number of Matches: 2
Related Information
Range 1: 18 to 764GenBank[[@http://www.ncbi.nlm.nih.gov/nuccore/12621057?report=graph&rid=X0REJNBM01R[12621057]&tracks=[key:sequence_track,name:Sequence,display_name:Sequence,id:STD1,category:Sequence,annots:Sequence,ShowLabel:true][key:gene_model_track,CDSProductFeats:false][key:alignment_track,name:other%20alignments,annots:NG%20Alignments%7CRefseq%20Alignments%7CGnomon%20Alignments%7CUnnamed,shown:false]&v=0:801&appname=ncbiblast&link_loc=fromHSP|Graphics]] Next Match Previous Match
Alignment statistics for match #1||~ Score
| Expect |
Identities |
Gaps |
Strand |
|
|---|---|---|---|---|
| 1369 bits(741) |
0.0 |
745/747(99%) |
0/747(0%) |
Plus/Plus |
Range 2: 766 to 1094GenBank[[@http://www.ncbi.nlm.nih.gov/nuccore/12621057?report=graph&rid=X0REJNBM01R[12621057]&tracks=[key:sequence_track,name:Sequence,display_name:Sequence,id:STD1,category:Sequence,annots:Sequence,ShowLabel:true][key:gene_model_track,CDSProductFeats:false][key:alignment_track,name:other%20alignments,annots:NG%20Alignments%7CRefseq%20Alignments%7CGnomon%20Alignments%7CUnnamed,shown:false]&v=750:1110&appname=ncbiblast&link_loc=fromHSP|Graphics]] Next Match Previous Match First Match
Alignment statistics for match #2||~ Score
| Expect |
Identities |
Gaps |
Strand |
|
|---|---|---|---|---|
| 344 bits(186) |
1e-90 |
295/341(87%) |
34/341(9%) |
Plus/Plus |
JP 2009148270-A/20: LUCIFERASES, FLUORESCENT PROTEINS, NUCLEIC ACIDS ENCODING THE LUCIFERASES AND FLUORESCENT PROTEINS AND THE USE THEREOF IN DIAGNOSTICS, HIGH THROUGHPUT SCREENING AND NOVELTY ITEMS
GenBank: HV097611.1FASTA Graphics
Go to:
LOCUS HV097611 1279 bp DNA linear PAT 15-JUL-2011
DEFINITION JP 2009148270-A/20: LUCIFERASES, FLUORESCENT PROTEINS, NUCLEIC
ACIDS ENCODING THE LUCIFERASES AND FLUORESCENT PROTEINS AND THE USE
THEREOF IN DIAGNOSTICS, HIGH THROUGHPUT SCREENING AND NOVELTY
ITEMS.
ACCESSION HV097611
VERSION HV097611.1 GI:340198043
KEYWORDS JP 2009148270-A/20.
SOURCE Ptilosarcus gurneyi
ORGANISM <span style="color: #828282; text-decoration: none;">[[http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=161601|Ptilosarcus gurneyi]]</span>
Eukaryota; Metazoa; Cnidaria; Anthozoa; Octocorallia; Pennatulacea;
Subselliflorae; Pennatulidae; Ptilosarcus.
REFERENCE 1 (bases 1 to 1279)
AUTHORS Szent-gyorgyi,C. and Bryan,B.J.
TITLE LUCIFERASES, FLUORESCENT PROTEINS, NUCLEIC ACIDS ENCODING THE
LUCIFERASES AND FLUORESCENT PROTEINS AND THE USE THEREOF IN
DIAGNOSTICS, HIGH THROUGHPUT SCREENING AND NOVELTY ITEMS
JOURNAL Patent: JP 2009148270-A 20 09-JUL-2009;
Bruce Bryan,Christopher Szent-Gyorgyi,PROLUME LTD
COMMENT OS Ptilosarcus gurneyi
PN JP 2009148270-A/20
PD 09-JUL-2009
PF 05-JAN-2009 JP 2009000303
PR 01-OCT-1998 US 60/102939,27-MAR-1998 US 60/079624, PR
15-JUN-1998 US 60/089367
PI christopher szent-gyorgyi,bruce j bryan
CC Ptilosarcus Green Fluorescent Protein (GFP) (insert B) FH
Key Location/Qualifiers
FT CDS (7)..(720).
FEATURES Location/Qualifiers
<span class="feature"> source 1..1279
/organism="Ptilosarcus gurneyi"
/mol_type="unassigned DNA"
/db_xref="taxon:<span style="color: #828282; text-decoration: none;">[[http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=161601|161601]]</span>"
</span>ORIGIN
1 <span class="ff_line">gacaaaatga accgcaacgt attaaagaac actggactga aagagattat gtcggcaaaa</span>
61 <span class="ff_line">gctagcgttg aaggaatcgt gaacaatcac gttttttcca tggaaggatt tggaaaaggc</span>
121 <span class="ff_line">aatgtattat ttggaaacca attgatgcaa atccgggtta caaagggagg tccgttgcca</span>
181 <span class="ff_line">ttcgctttcg acattgtttc catagctttc caatacggga atcgcacttt cacgaaatac</span>
241 <span class="ff_line">ccagacgaca ttgcggacta ctttgttcaa tcatttccgg ctggattttt ctacgaaaga</span>
301 <span class="ff_line">aatctacgct ttgaagatgg cgccattgtt gacattcgtt cagatataag tttagaagat</span>
361 <span class="ff_line">gataagttcc actacaaagt ggagtataga ggcaacggtt tccctagtaa cggacccgtg</span>
421 <span class="ff_line">atgcaaaaag ccatcctcgg catggagcca tcgtttgagg tggtctacat gaacagcggc</span>
481 <span class="ff_line">gttctggtgg gcgaagtaga tctcgtttac aaactcgagt cagggaacta ttactcgtgc</span>
541 <span class="ff_line">cacatgaaaa cgttttacag atccaaaggt ggagtgaaag aattcccgga atatcacttt</span>
601 <span class="ff_line">atccatcatc gtctggagaa aacctacgtg gaagaaggaa gcttcgtgga acaacacgag</span>
661 <span class="ff_line">acggccattg cacaactgac cacaattgga aaacctctgg gctcccttca tgaatgggtg</span>
721 <span class="ff_line">tagaaaatga ccaatatact ggggaaaatc accaatatac tggggaaaat gaccaattta</span>
781 <span class="ff_line">ctggggaaaa tgaccaatat actgtagaaa atcaccaata tactggggaa aatgaccaat</span>
841 <span class="ff_line">ttactgggga aatgaccaat ttactgtaga aaatcaccaa tatactgtgg aaaatgacca</span>
901 <span class="ff_line">aaatactgta gaaatgttca cactgggttg ataaccgttt cgataaccgt ttggaagctt</span>
961 <span class="ff_line">gtgtatacaa gttatttggg gtcattttgt aatgtgtatg tgtgttgtat gatctataga</span>
1021 <span class="ff_line">cgtcgtcatt catagcttga atccttcagc aaaagaaacc tcgaagcata ttgaaacctc</span>
1081 <span class="ff_line">gacggagagc ataaagagac cgcacgtaca caaattataa taccagcagt tggaatcttt</span>
1141 <span class="ff_line">aaaccgatca aaactattaa tatatatata caccctgtat aacatatata tatatatata</span>
1201 <span class="ff_line">tctacatagt ttgatattga ttaaatctgt tcttgatcac taaaaaaaaa aaaaaaaaaa</span>
1261 <span class="ff_line">aaaaaaaaaa aaaaaaaaa</span>
Thursday, July 17, 2014
7/17
Finished moving tank and put it into place. Almost completely finished with plumbing just a few more connections to finish up tomorrow. Tank was filled with tap with bleach to sanitize. will drain and refill with saltwater when all plumbing is in place and leak free. Currently no leaks.
Revision to Methods
Instead of just having a sand bottom to the tanks and Trash cans Jon recommend that I fill 2 gallon buckets that are 9" deep with sand and place them throughout the tank so that when the specimens need to bee transported I can bring up the bucket with sand hopefully not disturbing the specimen to much and transfer to a trash can. The specimen will be in the same substrate that it is used to hopefully making it easier to take samples.
Will also make it easier to collect substrate.
7/16
Primer information for coelenterazine
was amplified by PCR with primers containing the sequence encoding NdeI site, a bacterial periplasm localization signal (pelB) and XhoI site at the 5ʹ end and PstI site at the 3ʹ end.
Anaesthetizing
Cnidaria folks and vwlau For sea anemones, I pour an isotonic, fresh-water solution of 7 1/2% Epsom Salts = magnesium sulfate (from the drugstore - that’s the hydrated form, with 7 chemically associated water molecules, not the chemical reagent stuff without the associated water) into the container with the relaxed anemones to make a final solution that is about 1/2 seawater and 1/2 mgSo4 solution. The tricks I use are to prevent reaction/contraction by the animals is to cool the solution to the same temperature and aerate it thoroughly, and to condition the animal to water motion (by putting it near the water inflow area), first. Good luck! Liz Francis
http://maillists.uci.edu/pipermail/cnidaria/2004-March/000767.html
http://www.google.com.ni/patents/US6436682
Wednesday, July 16, 2014
7/15
A meeting with Jake cleared up a lot of the confusion in the procedures of my research.
Found a book with realted information to the system used for biolumenescence in the orange sea pen
Photoproteins in Bioanalysis edited by Sylvia Daunert, Sapna K. Deo looking into picking it up from UW libraries.
Methods- working on expanding need to speak with Dr. Roberts to discuss his intended kits so I can download info on use of each.
Animal collection and care
Tissue Sampling (Magnesium Sulfate Anesthesia?)
DNA Isolation (Qiagen DNEasy Kit, DNAzol method, etc)
Pick primer for PCR
PCR
RNA Isolation
cDNA
PCR/qPCR
Manipulation experiment
Luminescence Quantification
RNA/PCR/qPCR
Gene Sequencing?
Monday, July 14, 2014
7/14
Attended Lab meeting online had a few technical difficulties but I believe I have them all worked out if I can not make the meeting in the future I can Attend online and be able to interact.
Spoke with Jon about setting up the enclosure this week. We are still waiting to hear back from Greg about being able to use the Aquarium room to house the enclosure. Greg replied and said it would be fine so Jon and I will get everything up and running thursday at 1. He plans to move the Tank early tomorrow and we can hopefully have it up and running by thursday.
Started working on the proposal but I will need to speak with Dr. Roberts about some parts of it . Sent an email to schedule a meeting with him as well as Jake. (update-going to put together questions for Dr. Roberts and include them in an e-mail after meeting with Jake)
Created google Doc "https://docs.google.com/document/d/15zQqsOAc0LP0_hbktm-GUAUWwspLUh6cN15MgJzoEng/edit?usp=sharing" to make proposal more accessible
Created possible questions for research
1. What is the genetic sequence and proteins responsible for luminescence in P. gurneyi.
2. Does changes in P. gurneyi environment effect its ability to produce light when touched. (not sure on setup yet, but ocean acidification may be best fit since it has a direct effect on levels of Calcium often used in luminescent reactions but still need to verify this.)
Thursday, July 10, 2014
07/10
Heard back from Tim Carpenter the curator of fish and invertebrates at the Seattle Aquarium.
- He recommeded 1.25-1.5 gpm for the flow rate and designing a chaotic flow rate instead of direct flow.
- Keeping the Pens between 48 to 53 degrees to slow down algal and any other potential problem growths.
- They feed them Artemia nauplii daily he said anything that would be used to promote coral or planktivorous anemones.
- Dim lighting
- 8" for sand bed is what his are kept in
( North of the Alki Fishing Reef if you have a boat or can scooter from Laurelhurst beach, 40-50 ft depth.
At the end of the Alki Pipeline (at 63rd Ave. south of Alki point) – long swim out, about 40 feet depth.
Faye Bainbridge Park, Bainbridge Island – 30-40 feet, easy shore access.
Twin Spits near Port Gamble – easy shore dive. )
Asked if he had any knowledge of the resilience to research since I will need to take samples for the genetic, an protein area of my research.
Wednesday, July 9, 2014
7/9
Meeting with Jon to start putting together a plan to setup enclosures. Found one ~200 gallon tank that should fit the needs of the project. He recommended that we setup in aquarium room but need to speak with Greg to verify. Tank is current located in storage in salmon hatchery and will need to be transferred over. Jon is not available to do so until next week so we are planning to move everything then. Will need to locate equipment to setup overflow and add circulation to the tank.
Jon also recommended finding a different food supply since culturing my own is not plausible for the size of experiment. I noticed in my reading (posts 7/7) that the Pens may not actually feed on phytoplankton but mainly detritus so their are many options to look into.
Learned I cannot collect specimens by myself because of permit needed. Uw has a permit but only certain individuals are covered under that permit. Will speak with Greg to see if he is willing to collect specimens for me. May need to look into getting a collection permit for myself for current and future research.
7/8
Meeting with Dr. Roberts
Reviewed lab calendar, lab wiki, archiving data, google+, lab meetings, blog posting and signed contract.
Joined Northwest dive club.
Unable to dive with Sonia but got in contact with some of her connections and found optimal dive sites with confirmed sitings of specimens (4 mile barges, fox island west wall, Sunny-side south of pipeline, Les Davis, Whidbey, Bainbridge island as well as alki reef.) Alki reef is supposed to have tons of them but I am not sure about acquiring specimens since Alki is a no take zone. Reviewed and signed lab contract.
requested access to lab wiki, and signed in a created document folder on school hard drive for storing files.
Need to make appointment with Sam White when he returns to go through lab safety and lab tour.
Scheduled Meeting with Jon to go over and plan setup for aquarium, as well as feeding resources for specimens.
Proposal due next Friday, Dr. Roberts will be in Friday Harbor so it needs to put as priority for next week.
Personal notes:
Rottifers may not be a valid food supply, Jon said he had problems with them in the past looking into an alternative may be nessacary refer to 7/7 blog post.
7/7
Species selected (Ptilosarcus gurneyi)
Aquarium Needs: large sand/Mud bed (species full grown average 2 feet, collect specimens 1' or smaller)
Species needs constant water flow (filter feeder, planktonic food supply needed)
Sump system for water circulation possible breeding ground for Plankton (copepods? Tigriopus californicus)
- Sump
- Aquarium
- pump
- overflow box
- intake circulation powerheads/circulation pump
- growth lights for sump and aquarium (add sand to sump as well as local marco algae for copepods)
- mechanical filtration?
Species collection Locations Bainbridge island, Whidbey island, Alki (spoke with LFS in the area no one knew of any good locataions but Greg has said that Bainbridge was a good location to find plus read (http://www.wallawalla.edu/academics/departments/biology/rosario/inverts/Cnidaria/Class-Anthozoa/Subclass_Alcyonaria/Order_Pennatulacea/Ptilosarcus_gurneyi.html ) an article stating that they are often found "behind whidbey island"
Got in contact with Jon Wittouck <wittouck@uw.edu> to put together
everything needed for aquarium setup
Update: Jon replied and told me we should not have any
trouble getting everything set up raised a good question
to check "biomass of plankton filtered out of water per day" to establish feeding needs
Species creates luminescent mucous?
Species needs large sandbed or lower stalk can becomen inflamed.
T.carpenter@seattleaquarium.org-e-mail sent requesting information on Sea pen needs and possible diving sites.
LFS
BARRIER REEF renton(copepods)
1717 NE 44th St, Renton, WA 98056 (425) 277-7670
Saltwater city, bellevue(copepods)
14150 NE 20th St F3, Bellevue, WA 98007 (425) 644-7050
The fish store, lake city
12320 Lake City Way NE, Seattle, WA 98125 (206) 522-5259
Denny's pretty world, Kirkland
12534 120th Ave NE, Kirkland, WA 98034 (425) 821-3800
Sierra pets, renton(copepods)
601 S Grady Way, Renton, WA 98057 (425) 226-3215
http://www.advancedaquarist.com/2003/10/inverts
Basic Aquarium handling and care
Diurnal pattern of expansion
Culture of Rotifiers recommended or artifical plankton SDMP (ESV's spray-dried marine phytoplankont), APR (Artificial Plankton - Rotifer), or "Size I" (50-100µm), Cyclop EEze if grouded up to small bits. Feeding on a regular basis
Check other types of plankton as better food supply
Online research shows mechanical filtration better for cold water systems since the cold temperature slows metabolic rates making it difficult to establish bacteria to properly cycle tank, and local live rock not porous enough to act as a good biological filter. (Check if tropical live rock/dead rock could be used as a replacement).live rock is a good habitat for copepods as well as macro algae (join aquarium blog to ask about cycling coldwater aquariums and types of filtration)
Passive Suspension Feeding in a Sea Pen: Effects of
Ambient Flow on Volume Flow Rate and
Filtering Efficiency
BARBARA A. BEST'
Department of Zoology, Duke University, Durham, North Carolina 27706
Reference:Biol.Bull.175:332-342. (December, 1988)
http://www.biolbull.org/content/175/3/332.full.pdf
Flow rate:
Small optimum 5-6 cm/s data shows optimum efficiency at 1.5 cm/s
Mediuim/large 8-9 cm/s
data shows optimum efficiency at 1.5 cm/s for both all sizes change from 1.5 to 6.0 decrease efficiency from 42.8-29.9%
optimum food particle size 10-25 microns
Height stats: sea pen with a rachis height of 7 cm, medium sea pen 15 cm high, and large sea pen 25 cm high
http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=52424
KingdomAnimalia – Animal, animaux, animals
SubkingdomRadiata
PhylumCnidaria Hatschek, 1888 – cnidarians, coelenterates, cnidaires, coelentérés, água viva, anêmona, caravela, cnidario, coral, hidra
SubphylumAnthozoa
ClassAnthozoa Ehrenberg, 1834 – corals, flower animals, sea anemones, anémones de mer, coraux, água viva, anêmona, antozoário, caravela, corais, gorgônia
SubclassOctocorallia Haeckel, 1866
OrderPennatulacea Verrill, 1865 – sea pens, sea panzies, sea pens
SuborderSubselliflorae Kükenthal, 1915
FamilyPennatulidae Ehrenberg, 1828
GenusPtilosarcus Verrill, 1865
SpeciesPtilosarcus gurneyi (Gray, 1860)
http://data.gbif.org/species/2258713/?extent=-129%2B41%2B-109%2B51&zoom=5&minMapLong=-129&minMapLat=41&maxMapLong=-109&maxMapLat=51&c[0].s=20&c[0].p=0&c[0].o=2258713
http://www.asnailsodyssey.com/LEARNABOUT/PEN/penFeed.php
Consolidation of research information
the food particles are unhatched brine-shrimp Artemia cysts