Went over the data collected on 12/7 of the PCR and tried to interpret the results.
Thought about the next steps I can take while I am still at the lab. At this point, my goal is acquire knowledge of the tools and techniques used in this lab; how procedures work, what to do when they fail and how to interepte the results. Therefore, my goal is not to be creative but to gain insight into techniques such as RNA extractions, PCR, Reverse transcription and so on. What I would like to do over the course of the few upcoming months is to reproduce a simple experimental project that utilizes these techniques. What I had in mind was to test different tissues of an organism for the presence or absence of a specific gene such as Vitellogenin.
Wednesday December 7th:
Performed electrophoresis of the PCR product prepared on 12/6 by:
a. Preparing 1.2% agarose gel.
b.Running the gel.
From right to left:
HyperLader, Negative control1, Negative control2,Positive control(gonadal cDNA), mantle, gill.
Explanation: My positive control that had gonadal cDNA did not produce a band even though it did on the previous trial. I do not know why this happened but it could be possible that I missed the step where I ensure that the cDNA is mixed well. Also, is it possible that the cDNA got damaged But again, I am not sure why it happened. One more observation is that in the first trial of November 15th, out of the two samples Experimental 1, Experimental 2, only one of those produced a band. Therefore, out of three trials, the band was seen only once.
Tuesday December 6th:
Performed PCR using genomic DNA- samples from gill and mantle were used-
F primer: CTCAACAGCCCTGGTGGCGG SR ID: 1414
R primer: AGCGGTTCCGACTGCTCCCT SR ID: 1415
Product size: 723
Thermocycler parameters:
95°C - 10mins
40 cyles of:
95°C - 15s
55C - 15s
72°C - 30 sec
Monday December 5th:
Attended lab meeting.
Tuesday November 15th:
Performed electrophoresis of the PCR product prepared on 11/4 by:
a. Preparing 1.2% agarose gel.
b.Running the gel.
Column on the far right: HyperLader
From right to left:
Control 1, Control 2, Experimental* 1, Experimental 2
*Containing gonadal cDNA
Thursday November 10th:
Performed PCR using cDNA from gonadal tissue.
F primer: CTCAACAGCCCTGGTGGCGG SR ID: 1414
R primer: AGCGGTTCCGACTGCTCCCT SR ID: 1415
Product size: 723
Thermocycler parameters:
95°C - 10mins
40 cyles of:
95°C - 15s
55C - 15s
72°C - 10s - 2mins
Wednesday November 9th:
Performed electrophoresis of the PCR product prepared on 11/4 by:
a. Preparing 1.2% agarose gel.
b.Running the gel.
Friday November 4th:
Performed PCR following the same procedure as in October 19th.
cDNA from Gigas pool (20116311 cDNA), tissues: gill, mantle and muscle).
F primer: CTCAACAGCCCTGGTGGCGG SR ID: 1414
R primer: AGCGGTTCCGACTGCTCCCT SR ID: 1415
Product size: 723
Thermocycler parameters:
95°C - 10mins
40 cyles of:
95°C - 15s
55C - 15s
72°C - 10s - 2mins (dependent on amplicon size; ~1000kb/min)
Monday November 1st:
Designed primers for the Vitellogenin gene using Geneious and entered the data in the primers' data sheet.
Wednesday October 26th:
Learned how to use Geneious and Blast.
Performed a Blast in order to see where the primers anneal to the DNA sequence. Results show that the forward primer anneals at 553-575 and the reverse does not anneal anywhere.
One other possible explanation is that the tissues examined were not reproductive tissues and therefore vitellogenin was not expressed.
Here is the paper the primer was taken out of:
http://www.bioone.org/doi/abs/10.2108/zsj.20.37
Friday October 21st:
Prepared 1.2% agarose gel using the same procedure as in 10/5.
Run PCR: product size 310bp
Accession# AB084783
Wednesday October 19th:
Performed PCR for cDNA from Gigas pool (20116311 cDNA), tissues: gill, mantle and muscle).
Same procedure performed as in September 29th.
Primers used:
Cg_Vg2 F TTCACAGTCATGGAGCCCAGCAT SR ID 1355
Cg_Vg2 R GCAGATGGAAGGATGTGTCCACAG SR ID 1356
Thermocycler parameters:
95°C - 10mins
40 cyles of:
95°C - 15s
55C - 15s
72°C - 10s - 2mins (dependent on amplicon size; ~1000kb/min)
Tuesday October 18th:
Shadowed Mac as she performed cloning for her PCR product.
Monday October 17th:
Interesting Vg articles:
http://www.sciencedirect.com/science/article/pii/0016648091901859
Estradiol-induced vitellogenin gene expression in a teleost fish, oreochromis aureus
The effects of estradiol-17β-propionate on vitellogenin gene expression in male Oreochromis aureuswere reported. The vitellogenin mRNA transcript was detected as early as 1 hour following primary and secondary estradiol-stimulations, but the rate of accumulation of vitellogenin-specific mRNA was 20-fold higher after the second stimulation.
http://www.sciencedirect.com/science/article/pii/S0303720700003014
Contrasting effects of estrogen on transthyretin and vitellogenin expression in males of the marine fish, Sparus aurata
17β-estradiol (E2) treatment of S. aurata males resulted in increased synthesis and secretion of VTG protein into the plasma in a time-dependent manner. While VTG mRNA was induced by E2 treatment, transthyretin, a plasma protein (TTR) mRNA levels were reduced.
http://www.sciencedirect.com/science/article/pii/S1096495901003220
Multiple responses in gene expression in fish treated with estrogen
Fish injected with estradiol-17β showed an up-regulation in vitellogenin and several vitelline envelope proteins indicating that genes for proteins involved in egg development and maturation are susceptible to environmental estrogen exposure. While physiological changes caused by estradiol treatment are not totally explained by changes at the mRNA level, those changes can nevertheless be used as fingerprints to characterize an in vivo estrogenic response.
Wednesday October 12th:
Shadowed Sam as he performed cloning and obtained primer information for my PCR product.
Tuesday October 11th:
Attended lab meeting where Mac gave an overview of the Spain Conference.
The group discussed what they are currently doing, issues they encounter and future directions.
Prepared 1.2% Agarose gel and run PCR.
Primers used:
Cg_Vg2 F TTCACAGTCATGGAGCCCAGCAT SR ID 1355
Cg_Vg2 R GCAGATGGAAGGATGTGTCCACAG SR ID 1356
Product size: 310 bp
Thursday October 6th:
Repeat PCR with four controls, no template added.
Procedure followed is the same the previous one with the exception of not adding cDNA to any of the aliquots.
Thermocycler parameters:
95°C - 10mins
40 cyles of:
95°C - 15s
50°-60C - 15s
72°C - 10s - 2mins (dependent on amplicon size; ~1000kb/min)
Wednesday October 5th:
Prepared 1.2 % Agarose gel:
1. Tape the edges of the frame/casting tray to allow it to contain the gel.
*Add comb with the appropriate number of wells*
2. Measure 75ml of TAE with a graduated cylinder.
3. Using a weigh boat, weighed 1.00g of agarose. Use a disposable spatula.
4. In an Erlenmeyer flask, I mixed 75ml of TAE with 1.00g agarose and microwaved the mix for 3 minutes.
5. Every minute or so, swirl the mixture for a few second while keeping the flask away from face.
6.Add 6uL of ethidium bromide (that's what intercalates the DNA and makes it visible under UV light) to the mix and let it cool down.
7.Pour the mix intro the casting tray and let it sit for 30 minutes to harden.
8. Rinse the Erlenmeyer flask with water, then soap then water again and let it dry.
Loading the gel:
1.Get the reagents out of the freezer and let the PCR solution thaw. Put the rest of the reagents back in the freezer right away.
2. Remove tape from the edges of the casting tray and insert the get in the electrophoresis system.
3. Add TAE to the gel until it is fully submerged. Remove the comb and add a little more TAE to submerge the wells.
4.Plug the electrophoresis system (-) where the wells are, (+) end of the gel.
5. Load the gel with 6uL hyper lader in the first well, the entire volume of rest: control1, control2, sample1. sample2.
6. Turn on the power supply to 107V and watch for bubbles as they indicate that the procedure is working.
Visualizing the gel:
Place the gel under the UV light tranlinker, turn off the lights and visualize the gel.
Negative control seems to be contaminated.
Friday September 30th:
Some interesting research papers related to vitellogenin:
http://www.sciencedirect.com/science/article/pii/S0166445X10000858
http://www.sciencedirect.com/science/article/pii/S0147651310002216
Thursday September 29th:
Performed PCR with cDNA from salmon liver tissue.
Procedure followed:
1. For a reaction volume of 25uL, 12.5 uL of Apex Red was needed due to its concentration ( 2x Apex Red). Apex Red contains buffer, bases, polymerase)
2. Number of samples=4, two negative controls, two experimental.
3. Experimental samples contained:
12.5 uL Apex Red
0.5uL Forward primer (10uM) 5 GCG CAG AAC GAC GAG GCC A 3
0.5uL Reverse primer (10uM) 5 GGG ATG CAG CGA CCG TTC CC
Water 10.5uL
cDNA 1uL
4. Prepare the master mix that contains all components - cDNA:
50uL Apex Red
2.0 F primer
2.0 R primer
42.0 Water
5.Tap the tube and then spin in the centrifuge for about one minute to get the liquid off of the edges of the tube
6.Make aliquots of 24uL into each tube, add 1uL cDNA to two tubes.
7.make sure all the caps are tightly closed and then put in the thermacycler
Typical cycling parameters (ask for help on using the thermal cycler):
95C - 10mins
40 cyles of:
95C - 15s
50-60C - 15s
72C - 10s - 2mins (dependent on amplicon size; ~1000kb/min)
Wednesday September 28th:
Attended the writing workshop and learned how to properly share my calendar with the Robert's lab.
Notes:
Make sure to change the pipette tips every time you add a solution.
Do not put hand inside bag of tubes but rather, try pouring them out slowly to avoid contamination
Monday September 26:
Did some reading on sequencing technologies: Pyrosequencing, SOLiD, Illumina.
Tuesday September 20th:
Discussed Caroline's, Dave's, Emma's and Mac's project with Sam and got an idea of the techniques they use.
Went over techniques such as High-Throughput sequencing, Pyrosequencing and Illumina.
Made a short trip to the lab where the fish is kept and to the labs where all the high-tech instruments are.
Monday September 19th:
Was introduced to Sam's project: Characterizing Cyclooxygenase in oysters, by sequencing the gene and pointing out interesting features it might have, homologs, looking at gene expression in different tissues.
Went over how to design primers, what blast is and how it works, how sequencing works, why cloning is used and SNP's.
Friday September 16th:**
-Got acquainted with Derek's project as far as the main question addressed in his research. The impact of esthetic estrogen on the physiology of oysters: Reproduction, immune system, hormone levels.
-Derek explained how to prepare aragose gel for PCR:
1. Fill up the loading tray with water to determine the volume of TAE needed (150ml)
2.Tap around the edges of the loading tray to allow for the solution to be contained
3.Choose teeth depending on how many samples are to be run
4.Take 0.8% of the volume of the TAE: 150x 0.008= 1.2 g of Agarose
5. Microwave the solution until boiling point
6. Keep away from face when taking out from the microwave
7. Let it cool down for about 20 minutes and then add water to compensate for the evaporated solutio
8. Add ethidium bromide 15 microL
9.Let it solidify
-Observed Derek perform his PCR