November 4th, 2011

October 27th, 2011

Controls appear to have higher levels of Vtg expression than 7 or 35 day exposed fish.
Average adjusted value:
CC: 0.069
T7: 0.061
T35: 0.001

Reverse Transcription of 4 T7 and 4 T35 samples following Roberts Lab Protocol.
Max volume 17.75 uL RNA used (+ 0.5 uL Oligo dt Primer)
Master Mix:
Buffer: 5uL x 9 = 45uL
dNTPs: 1.25uL x 9 = 11.25 uL
M-MLV RT: 0.5uL x 9 = 4.5 uL

qPCR of 4 CC, 4 T7, and 4 T35 samples using Vitellogenin and 18s Primers.

Master Mix x 17.5 (Vitellogenin)

2x Sso Fast EvaGreen - 10 uL x 17.5 = 175 uL
F3 Primer - 0.5 uL x 17.5 = 8.75 uL
R3 Primer - 0.5 uL x 17.5 = 8.75 uL
PCR H2O - 8 uL x 17.5 = 140 uL

Master Mix x 17.5 (18s)

2x Sso Fast EvaGreen - 10 uL x 17.5 = 175 uL
F3 Primer - 0.5 uL x 17.5 = 8.75 uL
R3 Primer - 0.5 uL x 17.5 = 8.75 uL
PCR H2O - 8 uL x 17.5 = 140 uL

	1	2	3	4	5	6	7	8
A	Vtg NTC 1	Vtg CC-21	Vtg T7-7	Vtg T35-7	18s NTC 1	18s CC-21	18s T7-7	18s T35-7
B	Vtg NTC 2	Vtg CC-22	Vtg T7-8	Vtg T35-8	18s NTC 2	18s CC-22	18s T7-8	18s T35-8
C	Vtg NTC 3	Vtg CC-23	Vtg T7-9	Vtg T35-9	18s NTC 3	18s CC-23	18s T7-9	18s T35-9
D	Vtg Pos Cntrl	Vtg CC-24	Vtg T7-10	Vtg T35-10	18s Pos Cntrl	18s CC-24	18s T7-10	18s T35-10

All samples were run at 0.1x

October 25th, 2011

RNA extraction on T7-7-10, and T35-7-10 following Roberts Lab Protocol
Samples stored at -80

October 18th, 2011

Repeat qPCR of all four samples using primer pair 3, in addition to the old 18 samples (CC-1-6, T7-1-6, and T35-1-6) with Primer Pair 3. All samples were run at 0.1 x concentrations, with the positive control CC-1 cDNA from 7/6/11. 2 NTC were run.
Master Mix x 28.5

2x Sso Fast EvaGreen - 10 uL x 28.5 = 285 uL
F3 Primer - 0.5 uL x 28.5 = 14.25 uL
R3 Primer - 0.5 uL x 28.5 = 14.25 uL
PCR H2O - 8 uL x 28.5 = 228 uL

19 uL MM + 1 uL sample in each well.
Spin at 3000 G for 1 min, qPCR.

Amplification was seen in 3 of the 4 new samples (CC-22-24), and the melt peaks were of various heights at the 82 degree peak. The old samples showed a variety of amplification. Most of them smplified, but many of them either had double peaks in the melt peak graph, or single peaks shifted to more like 84 degrees. The current samples are fairly consistent, the older ones are not as clean.

October 17th, 2011

qPCR of all four samples using primer pair 3. Samples were run at 1x and 0.1 x concentrations, with the positive control CC-1 cDNA from 7/6/11. 2 NTC were run.
Master Mix x 13.5

2x Sso Fast EvaGreen - 10 uL x 13.5 = 135 uL
F3 Primer - 0.5 uL x 13.5 = 6.75 uL
R3 Primer - 0.5 uL x 13.5 = 6.75 uL
PCR H2O - 8 uL x 13.5 = 108 uL

19 uL MM + 1 uL sample in each well.
Spin at 3000 G for 1 min, qPCR.

October 14th, 2011

Conventional PCR following Lab Protocol

Master Mix Primer Pair 1:
Apex Red - 12.5 uL x 7 = 87.5 uL
F1 Primer - 0.5 uL x 7 = 3.5 uL
R1 Primer - 0.5 uL x 7 = 3.5 uL
Template 2 uL
PCR H2O - 9.5 uL x 7 = 66.5 uL

Repeat two more times, but replace F1and R1 with F3 and R3, and F1 and Rdes. 2 NTC per primer pair

Thermocycle Parameters
95°C - 10 min
40 cycles of:
95°C - 15 sec
60°C - 15 sec
72°C - 30 sec

Make 75 ml 1.2% agarose gel with 20 wells.

Ran gel for 30 minutes.



Appears to be some carry over in the NTC. Primer pair 3 band between 200 and 300, and product length should be 234 bp, so looks good.

October 13th, 2011

Conventional PCR following Lab Protocol

Master Mix Primer Pair 1:
Apex Red - 12.5 uL x 7 = 87.5 uL
F1 Primer - 0.5 uL x 7 = 3.5 uL
R1 Primer - 0.5 uL x 7 = 3.5 uL
Template 2 uL
PCR H2O - 9.5 uL x 7 = 66.5 uL

Repeat two more times, but replace F1and R1 with F3 and R3, and F1 and Rdes. 2 NTC per primer pair

Thermocycle Parameters
95°C - 10 min
40 cycles of:
95°C - 15 sec
55°C - 15 sec
72°C - 30 sec

Make 75 ml 1.2% agarose gel with 20 wells.

Ran gel for 30 minutes.

October 11th, 2011

RNA extraction on CC-21-24 following Roberts Lab Protocol
Samples stored at -80

Reverse Transcription of all 4 samples following Roberts Lab Protocol.
Max volume 17.75 uL RNA used (+ 0.5 uL Oligo dt Primer)
Master Mix:
Buffer: 5uL x 5 = 25uL
dNTPs: 1.25uL x 5 = 6.25 uL
M-MLV RT: 0.5uL x 5 = 2.5 uL

Samples stored at -20.

October 10th, 2011

Ordered 5 primers. 2 pairs, and one reverse primer we designed to span an intron. See Steven's Notebook for further details.

August 23rd, 2011

PCR Gel

August 17th, 2011

Standard PCR
18 cDNA samples
4 old cDNA samples
3 NTC

2x Apex Red - 12.5 x 28 = 350 uL
F Primer - 0.5 x 28 = 14 uL
R Primer - 0.5 x 28 = 14 uL
Template - 2 uL
H2O - 9.5 uL x 28 = 266 uL

Run COL
95°C - 10 min
then cycles of
95°C - 15 sec
50°C - 30 sec
72°C - 30 sec
Store at 4°C

August 1st, 2011

Serial Dilutions (0.1x and 0.01x) of two samples from each treatment group (CC-3, CC-4, T7-3, T7-4, T35-3, T35-4)

qPCR the 1x and diluted samples to see if dilution was necessary.




Effectively, there was only amplification in one sample, a 0.01x dilution of one of the 7-day exposure samples.

I re-ran the test, because there was weird lines showing up from the empty wells.

The results from the second run are as follows:




The positive control showed up well, and the rest of the samples either didn't amplify, or they look strange. Reverse transcription may not have been successful.

July 28th, 2011

Reverse Transcription of all 18 samples (6 control, 7-day, and 35-day treated) following Roberts lab protocol.

1 ug RNA used per sample.

Master Mix
Buffer - 5 x 20 = 100 uL
dNTPs - 1.25 x 20 = 25 uL
M-MLV - 0.5 x 20 = 10 uL

July 26th, 2011

Run qPCR on serial dilutions of CC-1 cDNA and CC-T35-1 cDNA.
For both samples, a 1x, 0.1x, 0.01x, 0.001x, and 0.0001x dilutions were run, along with 3 non-template controls.
Two of the non-template controls were clean, one appears to have been contaminated. Both 1x samples showed curves similar to the previous trials, and the 0.1x dilutions gave the closest to normal curves.






The top 2 peaks are the 0.1x dilutions, followed by the 0.01x dilutions (and the contaminated NTC), followed by the 0.001x and 0.0001x from the T35 sample, followed by the 0.001x dilution from the CC sample. There was no amplification of the 0.0001x CC sample. Both of the non-diluted samples produced curves of similar shapes to the previous runs.

July 25th, 2011

Re-do same qPCR as 7/22/11

July 22nd, 2011

Turbo DNA Cleanup

Remove genomic DNA from RNA extract using Ambion TURBO DNA-free kit, rigorous procedure. To get 5 ug of RNA, divide 5000 by sample concentration (ng/ul).

1. Add 0.1 volume 10X TURBO DNase Buffer and 1 μL TURBO DNase to the RNA, and mix gently.

• Rigorous DNase treatment: >200 μg nucleic acid per mL or RNA that is severely contaminated with DNA (i.e. >2 μg DNA/50 μL)

Rigorous DNase treatment: If the RNA contains more than 200 μg of nucleic acid per mL, dilute the sample to 10 μg nucleic acid/50 μL before adding the TURBO DNase Buffer and TURBO DNase. It is also helpful to add only half of the TURBO DNase to the reaction initially, incubate for 30 min, then add the remainder of the enzyme and incubate for another 30 min. If the sample cannot be diluted, simply increase the amount of TURBO DNase to 2–3 μL (4–6 U). It may be possible to successfully remove contaminating DNA from samples containing up to 500 μg/mL nucleic acid in a 10–100 μL TURBO DNAfree reaction. However, the efficacy of treating highly concentrated nucleic acid samples depends on the absolute level of DNA contamination, and residual DNA may or may not be detectable by PCR after 35–40 cycles.
2. Incubate at 37°C for 20–30 min. If only half of the TURBO DNase was added in step 1, incubate for 30 min, then add the rest of the TURBO DNase and incubate for 30 min more.
3. Add resuspended DNase Inactivation Reagent (typically 0.1 volume) and mix well. Always resuspend the DNase Inactivation Reagent by flicking or vortexing the tube before dispensing it.
• For routine DNase treatment use 2 μL or 0.1 volume DNase Inactivation Reagent, whichever is greater. For example, if the RNA volume is 50 μL, and 1 μL of TURBO DNase was used in step 1, add 5 μL of DNase Inactivation Reagent.
• For rigorous DNase treatments, where 2–3 μL of TURBO DNase was used, add 0.2 volumes of DNase Inactivation Reagent.
IMPORTANT: Always use at least 2 μL of DNase Inactivation Reagent, even if it is more than 0.1 volume.
NOTE: The DNase Inactivation Reagent may become difficult to pipette after multiple uses due to depletion of fluid from the interstitial spaces. If this happens, add a volume of Nuclease-free Water (supplied with the kit) equal to approximately 20–25% of the bed volume of the remaining DNase Inactivation Reagent, and vortex thoroughly to recreate a pipettable slurry.
4. Incubate 2 min at room temp, mixing occasionally. It is important to mix the contents of the tube 2–3 times during the incubation period to redisperse the DNase Inactivation Reagent.
5. Centrifuge at 10,000 x g for 1.5 min and transfer the RNA to a fresh tube.
• For 96 well plates, centrifuge at 2000 x g for 5 min. This centrifugation step pellets the DNase Inactivation Reagent. After centrifuging, carefully transfer the supernatant, which contains the RNA, into a fresh tube. Avoid introducing the DNase Inactivation Reagent into solutions that may be used for downstream enzymatic reactions, because it can sequester divalent cations and change the buffer conditions.

Store samples at -80

qPCR of cleaned up samples

2x Sso Fast EvaGreen - 10 uL x 23 = 230 uL
F Primer - 0.5 uL x 23 = 11.5 uL
R Primer - 0.5 uL x 23 = 11.5 uL
H2O - 8 uL x 23 = 184 uL

CC-1 cDNA = Positive control

1. Aliquot 19 uL Master Mix into each of 21 wells on PCR plate.
2. Add 1 uL PCR grade water to 2 wells for NTC
3. Add 1 uL CC-1 cDNA to well for positive control
4. Add 1 uL template to remaining 18 wells respectively
5. Cap tray tightly, centrifuge at 3000 g for 1 min (with balance)
6. Go to Friedman lab (with Sam) to run qPCR

July 21st, 2011

RNA extraction on CC-3-6, CC-T35-3-6, and CC-T7-1-6 according to Roberts lab protocol.

Samples stored in -80.

July 7th, 2011

Make gel and run normal PCR on 4 samples.

1. Make 1x TAE from stock 50x TAE container. 20 uL stock to 1 L Nanopure H2O (found above microwave)
2. Mix well
3. Measure out 75 mL 1x TAE into 500 mL Erlenmeyer flask
4. Measure out 1 g agarose/75 mL TAE
5. Swirl and microwave for 3 minutes, swirling periodically (use paper towel to hold flask because glass will be hot)
6. Swirl briefly on counter to cool
7. Add 7.5 uL ethidium bromide (from fridge) and swirl
8. Pour into gel tray making sure comb is set before hand.
9. Let sit for about 30 minutes to cool.

PCR

1. Place gel in gel box
2. Cover in TAE
3. Slowly remove well tray
4. Load 8 uL of hyper ladder -1 into last wekk
5. Load 20 uL of sample in each sample in each well.
Ladder / CC-1 / CC-2 / CC-T35 - 1 / CC-T35-2 / NTC -1 / NTC -2
6. Place lid on tray.
7. Always run negative to positive, turn on 100V, run for 30 minutes.
8. Turn power off
9. Take gel out, put on light box, close shield, and view

NCBI genbank
PrF: 5' - CTCAGGGAGTGTGCAAGACC - 3' (58bp-77bp)
PfR: 5' - CTCTGCCGGCACTCTACAC - 3' (196bp-214bp)

214-58 = 156 bp long

July 6th, 2011

Reverse Transcription of 4 RNA extractions according to Roberts lab protocol, followed by conventional PCR.

Reverse Transcription (Promega M-MLV Protocol)

A single reaction volume = 25uL. The volume of RNA, primer(s) and M-MLV RT used are variable and will be specific to your current experiment. The directions below apply to a reaction using 1ug of total RNA. You may need to make changes to accommodate your own conditions.

1. Use as much RNA as possible, max volume of RNA = 17.75uL. Generally, identify the RNA sample with the lowest concentration and multiply by 17.75uL. Use this quantity (ug) of RNA for each and every sample.
2. Transfer calculated volume(s) of RNA to 0.5mL snap cap tubes or PCR plate. Adjust volumes of individual samples to 17.75uL with H2O.
3. Add appropriate amount of primer to sample. Use 0.25ug primer per 1ug of RNA in sample (= 0.5uL of Promega oligo dT in this example). Total volume (RNA + primers) should equal 18.25uL.
4. Heat samples at 70C for 5 min in thermocycler.
5. Place samples on ice IMMEDIATELY.
6. Make Master Mix:

PER RXN
5 uL 5x Buffer (M-MLV RT Buffer)
1.25 uL 10mM dNTPs
0.5 uL M-MLV RT per ug of RNA

7. Mix well.
8. Add 6.75uL of master mix to each reaction.
9. Mix well, but do not vortex.
10.Spot spin.
11.Incubate @ 42C for 1hr in thermalcycler for oligo dT primers OR @ 37C for random primers.
12.Heat inactivate @ 95C for 3 min.
13.Spot spin.
14.Store @ -20C.

Master Mix Calculation (x 4.5 to account for 4 samples plus some extra)

Buffer: 5 uL x 4.5 = 22.5 uL
dNTPs: 1.25 uL x 4.5 = 5.625 = 5.63 uL
M-MLV: 0.5 uL x 4.5 = 2.25 uL

Conventional PCR (2x Apex Red)

Single reaction (25uL) set up is listed below. Be sure to make a master mix volume that will accommodate all of your samples, two water (no template controls; NTC) samples, plus an extra 10% to accommodate pipetting errors. Distribute appropriate amount of master mix (volume of master mix + template = 25uL) to PCR tubes or PCR plate. Make sure all tubes/caps are tightly closed. Put in thermalcycler.

Reaction_Components	Volume	Final Concentration
2x Apex Red	12.5	1x
Forward Primer (10uM)	0.5	0.2uM
Reverse Primer (10uM)	0.5	0.2uM
Template	Up to 5uL
H2O (PCR grade)	variable	Use to bring reaction volume up to 25uL

Typical cycling paramaters (ask for help on using the thermal cycler):

95C - 10mins
40 cyles of:
95C - 15s
50-60C - 15s
72C - 10s - 2mins (dependent on amplicon size; ~1000kb/min)

Master Mix Volume (x7 to account for 4 samples, 2 non template controls, and one extra)

2x Apex Red - 12.5 uL x 7 = 87.5 uL
forward primer - 0.5 uL x 7 = 3.5 uL
reverse primmer - 0.5 uL x 7 = 3.5 uL

Forward Primer: 54901899 IDT S. White (42805692)
PF_nerka_VTG-F Tm = 57.8

Reverse Primer: 54901900 IDT S.White (42805693)
PF_nerka_VTG_R Tm = 57.9

June 30th, 2011

RNA extraction on 2 control samples and 2 samples from the 35 day exposed fish according to following Roberts lab protocol.

RNA Extraction

Manufacturers' Protocol - MRC

1. Turn centrifuge on to cool to 4C
2. Clean Homogenizer

- Rinse in DEPC water in 50 ml falcon tube (3x – 3 separate tubes)

1. Get sample and thaw enough to get out of container
2. Measure weight of sample
3. Take sample out (screw out and use forceps) and chop up with sterile razor blade
4. Put tri-reagent (stays on ice when not using & is light sensitive) into 50 ml falcon tube (or smaller tube depending on size of sample) – for a 0.7 gram sample I used 7 ml of tri-reagent. Note: in 50 ml falcon tube need at least 3 ml of tri-reagent to get it to work
5. Add sample
6. Keep on ice
7. Blot homogenizer with paper towel to remove excess water
8. Homogenize sample (don’t leave off ice for too long)
9. Homogenize until sample is in solution
10. Transfer all or part (I kept 6 ml) of mixture into a 13 ml tube (only add up to 7 ml)
11. Let sit for 5 min at RT
12. Rinse homogenizer in DEPC water (same tube used to clean in the beginning)
13. Add 0.2 ml of chloroform (under hood, open only in hood, pour into glass beaker first) per 1 ml of tri-reagent
14. Cover & shake
15. Let sit for 15 min at room temp
16. Change gloves
17. Spin at 12,000 x g (11,500 rpm) for 15 min at 4C
18. Transfer aqueous (top) phase to fresh tube (top layer has the RNA in it – bottom layer has DNA and proteins in it)
19. Add 3 ml iso. (2 – Propanol, under hood) to precipitate out the RNA
20. Cap and vortex
21. Let sit at RT for 10 min
22. Put waist with tri-reagent etc. in tri-reagent bottle in fume hood
23. Clean up homogenizer and put away (put in 50 ml falcon tube with 5-7 ml 30% H2O2 and up to 40 ml with DEPC water
24. Spin at 12,000 x g (11,500 rpm) for 15 min at 4C
25. Remove supernatant (I want the pellet – RNA)
    1. Get glass beaker and paper towels (small stack)
    2. Pour off supernatant into beaker and place tube upside-down on paper towels
    3. Note: do not rock the tube back and fourth or will loosen pellet
26. Add 1 ml 75% EtOH in DEPC water per 1 ml of tri-reagent added in beginning
27. Cap & move – rock back and fourth to loosen pellet – vortex if necessary
28. Spin 11,500 x rpm for 5 min at 4C
29. Remove supernatant again & put on paper towel – be much more careful to make sure pellet does not slip out
30. Spot Spin – turn on centrifuge, let go up to about 1000 rpm then shut off – note: place pellet facing upward
31. Use filter pipette tips to remove excess EtOH
32. Turn upside down on paper towels
33. Wait 10 mins
34. Depending on size of pellet add dnase free water to the tube – if taking to mRNA always use 500 ul (I used 500 ul for the ovary – large pellet, and 250 ul for the muscle)
35. Dissolved into solution by pipetting
36. Put in 1.5 ml tube
37. Put on ice
38. Spec to determine how much RNA you have
39. Store samples in -80 freezer