Since we’ve got trimmed input fastq files and a prepped genome, it’s time to start the alignment. This is the slow step, but the files aren’t super huge/there arenlt a ton, so hopefully this will only take a few days.
setwd("~/Documents/C-virginica-BSSeq/")
bismark.genome <- "~/Documents/C-virginica-BSSeq/genome"
trimmed.input.files <- list.files(pattern = "*.trimmed.fq")
for(i in 1:length(trimmed.input.files)) {
system(paste0("/home/shared/Bismark/bismark --multicore 9 -N 1 -q --genome ", bismark.genome, " --se ", trimmed.input.files[i], " -o ~/Documents/C-virginica-BSSeq/", substr(trimmed.input.files[i], 1, 17)))
}Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'FastQ format specifiedMapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: 2112_lane1_ACAGTG_L001_R1_trimmed.fq
Files to be analysed:
2112_lane1_ACAGTG_L001_R1_trimmed.fq
Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Created output directory /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/!
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing 2112_lane1_ACAGTG_L001_R1_trimmed.fq for PID: 0 and offset 7
Finished subdividing 2112_lane1_ACAGTG_L001_R1_trimmed.fq for PID: 0 and offset 8
Using the subset file >2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7< as new in-file (instead of >2112_lane1_ACAGTG_L001_R1_trimmed.fq<)
Using the subset file >2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8< as new in-file (instead of >2112_lane1_ACAGTG_L001_R1_trimmed.fq<)
Input file is in FastQ format
Input file is in FastQ format
Finished subdividing 2112_lane1_ACAGTG_L001_R1_trimmed.fq for PID: 0 and offset 3
Using the subset file >2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3< as new in-file (instead of >2112_lane1_ACAGTG_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8 to 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_C_to_T.fastq
Writing a C -> T converted version of the input file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7 to 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_C_to_T.fastq
Writing a C -> T converted version of the input file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3 to 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_C_to_T.fastq
Finished subdividing 2112_lane1_ACAGTG_L001_R1_trimmed.fq for PID: 6856 and offset 9
Using the subset file >2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9< as new in-file (instead of >2112_lane1_ACAGTG_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9 to 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_C_to_T.fastq
Finished subdividing 2112_lane1_ACAGTG_L001_R1_trimmed.fq for PID: 0 and offset 2
Using the subset file >2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2< as new in-file (instead of >2112_lane1_ACAGTG_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2 to 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_C_to_T.fastq
Finished subdividing 2112_lane1_ACAGTG_L001_R1_trimmed.fq for PID: 0 and offset 6
Using the subset file >2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6< as new in-file (instead of >2112_lane1_ACAGTG_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6 to 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_C_to_T.fastq
Finished subdividing 2112_lane1_ACAGTG_L001_R1_trimmed.fq for PID: 0 and offset 4
Using the subset file >2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4< as new in-file (instead of >2112_lane1_ACAGTG_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4 to 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_C_to_T.fastq
Finished subdividing 2112_lane1_ACAGTG_L001_R1_trimmed.fq for PID: 0 and offset 1
Using the subset file >2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1< as new in-file (instead of >2112_lane1_ACAGTG_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1 to 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_C_to_T.fastq
Finished subdividing 2112_lane1_ACAGTG_L001_R1_trimmed.fq for PID: 0 and offset 5
Using the subset file >2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5< as new in-file (instead of >2112_lane1_ACAGTG_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5 to 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_C_to_T.fastq
Created C -> T converted version of the FastQ file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6 (1489789 sequences in total)
Input file is 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5 (1489789 sequences in total)
Input file is 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1 (1489790 sequences in total)
Input file is 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7 (1489789 sequences in total)
Input file is 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9 (1489789 sequences in total)
Input file is 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3 (1489790 sequences in total)
Input file is 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2 (1489790 sequences in total)
Input file is 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8 (1489789 sequences in total)
Input file is 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4 (1489790 sequences in total)
Input file is 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1732:2172_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTTGTAAAAAATTATATTAATTTTTGTTGTTTATTAATTTTAATTAATTAATTAATAAATTTATTTTATAATTAATTGATTATTAATTATTATTGTTTAT ?@@ADFFFGBHGHIIIIIIIGGEGHIFIIIIGHIIIIIIIIIICHHIIIIACEHHFHHHEFFFFCCEEEDEDDDD@A?B8=BBDDDCDDDDCDECD@BDBC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1623:2154_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GAATGGAAGAGTATATGTTTGAATTTTAGTTATATAGTGATTTTGTATGTTGTTTTTTGTTTGAAAA ;?+=D?DDDD>DD;B?:23CEFFD?E9E?DDE<D@;?0?*9B9B87?BD>B0-@ADED:@)77?A?? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2162:2117_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTTGTTTTTTTTATTATTGTTATTGTTATTGTAAAAAATTATTAATTTTGATTTATTATTGTTTGTTGTTATGATATGATTTAAAA @@CFBDDDFHHFHIG:EGHGIGGFFHGIIIIIBFDDDDF;@FCHIGEHEHDFFCAEECAC;:=??@BB055;@9>09@B-59@C>>C YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1243:2121_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTATTAAATATTATGATTTTATTTGATAATAAATTTTAATTATATGTTATATTTATATTTTTTTTTTTTAATATATTTTGTTTATTAAATTATTTTATT CCCFFFFFHHHHHJJJAFHGIJJJJJGGIIGGIJJJIJJIJJIJIIJIIIJGHGHFHIJIJJJHFHHHHFFFFFFFEEEEDACDDDDECCCDDDDDDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1754:2166_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTGGTGTTTTTTATAATAGATGTAATGTGAGTAGTAGATTTTTTTTGTTGATAAGTAAGTATTTTATTTTGTGTATATATTTGGTTTTTTGTATTTTGGTG @@@DDDA1CFHHFIJGGGJJJFGGIJJJJDHBHJGHGIJJI;CECHI=EHIGHHEEEDFFDDEEEEDECD3;?;A>ACEECDCDCCCCDDDBCDCDEDCC@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1596:2158_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TGGTTATTGTTATTGTTTAGATTGTATTTGTGTTTTATGTGAATAGTTTAGTTTTGGAGGATGTAATTGATTGGTGAAGTGTGTTGTTTATTGGGATA =;14ADD?BFDHHGHIIIIIEIGGEHDFHHGECGFHEHEEDBGG@B?FGIIBHHGIIIIIEHE9BEC@=@B?BB555@C>ADCCCBBBBBECBBB@BB YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1771:2189_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GGATGGTGTGTGATAGATTGATTAATATGTAATTTAAAAAATATGATAGTATTTATTTTGTTAAAATATAAGGTTGGTTTTAGTAGGGTTTTTAA BC;DDFFFHHFHHIIGFGIJGIGIIIJJIIIJGIJJJJJJJGIHHGHHFEFFEFDEFEEEEEEEEDBBDBDBD:C9@<ADDDDDDDDD38?BCCC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1475:2133_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GGGTTAGGTTGATTTTAAATTTGAGGAAGTTTGTGTAGGAAGAGTTTATGAATATTTAAATTTTTTGTTATAGTTATAAGAAAAT B@?DFFFFCFHHGJJJJJJJJJJJJIIJJHIIJJIIIIIJJIGHGIJGIIJFIIJIJFHEHHGFFDDCEEDEEAA>ACCDDCDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2063:2158_1:N:0:ACAGTG 4 * 0 0 * * 0 0 AGTGGGGTGATGTTTTTATTGGTGTGG @@?DFFFDHHHHDHIJJJJJJIIII?F YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1732:2172_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTTGTAAAAAATTATATTAATTTTTGTTGTTTATTAATTTTAATTAATTAATTAATAAATTTATTTTATAATTAATTGATTATTAATTATTATTGTTTAT ?@@ADFFFGBHGHIIIIIIIGGEGHIFIIIIGHIIIIIIIIIICHHIIIIACEHHFHHHEFFFFCCEEEDEDDDD@A?B8=BBDDDCDDDDCDECD@BDBC YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1623:2154_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GAATGGAAGAGTATATGTTTGAATTTTAGTTATATAGTGATTTTGTATGTTGTTTTTTGTTTGAAAA ;?+=D?DDDD>DD;B?:23CEFFD?E9E?DDE<D@;?0?*9B9B87?BD>B0-@ADED:@)77?A?? YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1754:2166_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTGGTGTTTTTTATAATAGATGTAATGTGAGTAGTAGATTTTTTTTGTTGATAAGTAAGTATTTTATTTTGTGTATATATTTGGTTTTTTGTATTTTGGTG @@@DDDA1CFHHFIJGGGJJJFGGIJJJJDHBHJGHGIJJI;CECHI=EHIGHHEEEDFFDDEEEEDECD3;?;A>ACEECDCDCCCCDDDBCDCDEDCC@ YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1243:2121_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTATTAAATATTATGATTTTATTTGATAATAAATTTTAATTATATGTTATATTTATATTTTTTTTTTTTAATATATTTTGTTTATTAAATTATTTTATT CCCFFFFFHHHHHJJJAFHGIJJJJJGGIIGGIJJJIJJIJJIJIIJIIIJGHGHFHIJIJJJHFHHHHFFFFFFFEEEEDACDDDDECCCDDDDDDDDD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1596:2158_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TGGTTATTGTTATTGTTTAGATTGTATTTGTGTTTTATGTGAATAGTTTAGTTTTGGAGGATGTAATTGATTGGTGAAGTGTGTTGTTTATTGGGATA =;14ADD?BFDHHGHIIIIIEIGGEHDFHHGECGFHEHEEDBGG@B?FGIIBHHGIIIIIEHE9BEC@=@B?BB555@C>ADCCCBBBBBECBBB@BB YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2162:2117_1:N:0:ACAGTG 4 * 0 0 * * 0 0 TTTTGTTTTTTTTATTATTGTTATTGTTATTGTAAAAAATTATTAATTTTGATTTATTATTGTTTGTTGTTATGATATGATTTAAAA @@CFBDDDFHHFHIG:EGHGIGGFFHGIIIIIBFDDDDF;@FCHIGEHEHDFFCAEECAC;:=??@BB055;@9>09@B-59@C>>C YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2063:2158_1:N:0:ACAGTG 4 * 0 0 * * 0 0 AGTGGGGTGATGTTTTTATTGGTGTGG @@?DFFFDHHHHDHIJJJJJJIIII?F YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1771:2189_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GGATGGTGTGTGATAGATTGATTAATATGTAATTTAAAAAATATGATAGTATTTATTTTGTTAAAATATAAGGTTGGTTTTAGTAGGGTTTTTAA BC;DDFFFHHFHHIIGFGIJGIGIIIJJIIIJGIJJJJJJJGIHHGHHFEFFEFDEFEEEEEEEEDBBDBDBD:C9@<ADDDDDDDDD38?BCCC YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1475:2133_1:N:0:ACAGTG 4 * 0 0 * * 0 0 GGGTTAGGTTGATTTTAAATTTGAGGAAGTTTGTGTAGGAAGAGTTTATGAATATTTAAATTTTTTGTTATAGTTATAAGAAAAT B@?DFFFFCFHHGJJJJJJJJJJJJIIJJHIIJJIIIIIJJIGHGIJGIIJFIIJIJFHEHHGFFDDCEEDEEAA>ACCDDCDDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5
Reading in the sequence file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3
Reading in the sequence file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6
Reading in the sequence file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4
Reading in the sequence file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1
Reading in the sequence file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8
Reading in the sequence file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9
Reading in the sequence file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7
Reading in the sequence file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
1489790 reads; of these:
1489790 (100.00%) were unpaired; of these:
1362511 (91.46%) aligned 0 times
58996 (3.96%) aligned exactly 1 time
68283 (4.58%) aligned >1 times
8.54% overall alignment rate
1489790 reads; of these:
1489790 (100.00%) were unpaired; of these:
1364871 (91.61%) aligned 0 times
57938 (3.89%) aligned exactly 1 time
66981 (4.50%) aligned >1 times
8.39% overall alignment rateProcessed 1489790 sequences in total
Successfully deleted the temporary file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1489790
Number of alignments with a unique best hit from the different alignments: 99240
Mapping efficiency: 6.7%Sequences with no alignments under any condition: 1308066
Sequences did not map uniquely: 82484
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 50846 ((converted) top strand)
CT/GA: 48394 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2118309
Total methylated C's in CpG context: 352995
Total methylated C's in CHG context: 313401
Total methylated C's in CHH context: 999380
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 39328
Total unmethylated C's in CHG context: 164263
Total unmethylated C's in CHH context: 248942
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.0%
C methylated in CHG context: 65.6%
C methylated in CHH context: 80.1%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
1489790 reads; of these:
1489790 (100.00%) were unpaired; of these:
1365152 (91.63%) aligned 0 times
57781 (3.88%) aligned exactly 1 time
66857 (4.49%) aligned >1 times
8.37% overall alignment rate
1489790 reads; of these:
1489790 (100.00%) were unpaired; of these:
1362202 (91.44%) aligned 0 times
58939 (3.96%) aligned exactly 1 time
68649 (4.61%) aligned >1 times
8.56% overall alignment rateProcessed 1489790 sequences in total
Successfully deleted the temporary file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1489790
Number of alignments with a unique best hit from the different alignments: 99045
Mapping efficiency: 6.6%Sequences with no alignments under any condition: 1308304
Sequences did not map uniquely: 82441
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 50927 ((converted) top strand)
CT/GA: 48118 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2111236
Total methylated C's in CpG context: 352345
Total methylated C's in CHG context: 312694
Total methylated C's in CHH context: 995112
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 38947
Total unmethylated C's in CHG context: 164403
Total unmethylated C's in CHH context: 247735
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.0%
C methylated in CHG context: 65.5%
C methylated in CHH context: 80.1%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
1489790 reads; of these:
1489790 (100.00%) were unpaired; of these:
1364256 (91.57%) aligned 0 times
58176 (3.90%) aligned exactly 1 time
67358 (4.52%) aligned >1 times
8.43% overall alignment rate
1489790 reads; of these:
1489790 (100.00%) were unpaired; of these:
1361652 (91.40%) aligned 0 times
59032 (3.96%) aligned exactly 1 time
69106 (4.64%) aligned >1 times
8.60% overall alignment rateProcessed 1489790 sequences in total
Successfully deleted the temporary file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1489790
Number of alignments with a unique best hit from the different alignments: 99503
Mapping efficiency: 6.7%Sequences with no alignments under any condition: 1307240
Sequences did not map uniquely: 83047
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51070 ((converted) top strand)
CT/GA: 48433 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2122963
Total methylated C's in CpG context: 354940
Total methylated C's in CHG context: 314530
Total methylated C's in CHH context: 1002651
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 39514
Total unmethylated C's in CHG context: 164223
Total unmethylated C's in CHH context: 247105
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.0%
C methylated in CHG context: 65.7%
C methylated in CHH context: 80.2%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
1489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1364892 (91.62%) aligned 0 times
57810 (3.88%) aligned exactly 1 time
67087 (4.50%) aligned >1 times
8.38% overall alignment rate
1489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1362364 (91.45%) aligned 0 times
58810 (3.95%) aligned exactly 1 time
68615 (4.61%) aligned >1 times
8.55% overall alignment rateProcessed 1489789 sequences in total
Successfully deleted the temporary file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1489789
Number of alignments with a unique best hit from the different alignments: 99121
Mapping efficiency: 6.7%Sequences with no alignments under any condition: 1308022
Sequences did not map uniquely: 82646
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 50813 ((converted) top strand)
CT/GA: 48308 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2116848
Total methylated C's in CpG context: 352288
Total methylated C's in CHG context: 313700
Total methylated C's in CHH context: 1000711
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 39133
Total unmethylated C's in CHG context: 163859
Total unmethylated C's in CHH context: 247157
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.0%
C methylated in CHG context: 65.7%
C methylated in CHH context: 80.2%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
1489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1361398 (91.38%) aligned 0 times
59363 (3.98%) aligned exactly 1 time
69028 (4.63%) aligned >1 times
8.62% overall alignment rate
1489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1364952 (91.62%) aligned 0 times
57610 (3.87%) aligned exactly 1 time
67227 (4.51%) aligned >1 times
8.38% overall alignment rateProcessed 1489789 sequences in total
Successfully deleted the temporary file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1489789
Number of alignments with a unique best hit from the different alignments: 99406
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2121524
Total methylated C's in CpG context: 354023
Total methylated C's in CHG context: 314724
Total methylated C's in CHH context: 1000644
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 39615
Total unmethylated C's in CHG context: 164129
Total unmethylated C's in CHH context: 248389
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.9%
C methylated in CHG context: 65.7%
C methylated in CHH context: 80.1%
C methylated in Unknown context (CN or CHN): 100.0%Sequences with no alignments under any condition: 1307428
Sequences did not map uniquely: 82955
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51339 ((converted) top strand)
CT/GA: 48067 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1362244 (91.44%) aligned 0 times
58743 (3.94%) aligned exactly 1 time
68802 (4.62%) aligned >1 times
8.56% overall alignment rate
1489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1364562 (91.59%) aligned 0 times
58205 (3.91%) aligned exactly 1 time
67022 (4.50%) aligned >1 times
8.41% overall alignment rateProcessed 1489789 sequences in total
Successfully deleted the temporary file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1489789
Number of alignments with a unique best hit from the different alignments: 99367
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2122937
Total methylated C's in CpG context: 353859
Total methylated C's in CHG context: 314807
Total methylated C's in CHH context: 1001086
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 39348
Total unmethylated C's in CHG context: 165456
Total unmethylated C's in CHH context: 248381
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.0%
C methylated in CHG context: 65.5%
C methylated in CHH context: 80.1%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 1307706
Sequences did not map uniquely: 82716
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 50763 ((converted) top strand)
CT/GA: 48604 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1364987 (91.62%) aligned 0 times
57543 (3.86%) aligned exactly 1 time
67259 (4.51%) aligned >1 times
8.38% overall alignment rate
1489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1362780 (91.47%) aligned 0 times
58579 (3.93%) aligned exactly 1 time
68430 (4.59%) aligned >1 times
8.53% overall alignment rateProcessed 1489789 sequences in total
Successfully deleted the temporary file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1489789
Number of alignments with a unique best hit from the different alignments: 98851
Mapping efficiency: 6.6%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2104321
Total methylated C's in CpG context: 349916
Total methylated C's in CHG context: 311489
Total methylated C's in CHH context: 991182
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 39700
Total unmethylated C's in CHG context: 164137
Total unmethylated C's in CHH context: 247897
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.8%
C methylated in CHG context: 65.5%
C methylated in CHH context: 80.0%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 1308504
Sequences did not map uniquely: 82434
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 50708 ((converted) top strand)
CT/GA: 48143 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1365039 (91.63%) aligned 0 times
57804 (3.88%) aligned exactly 1 time
66946 (4.49%) aligned >1 times
8.37% overall alignment rate
1489789 reads; of these:
1489789 (100.00%) were unpaired; of these:
1362094 (91.43%) aligned 0 times
58995 (3.96%) aligned exactly 1 time
68700 (4.61%) aligned >1 times
8.57% overall alignment rateProcessed 1489789 sequences in total
Successfully deleted the temporary file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1489789
Number of alignments with a unique best hit from the different alignments: 99099
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2114777
Total methylated C's in CpG context: 351601
Total methylated C's in CHG context: 312978
Total methylated C's in CHH context: 1000731
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 39133
Total unmethylated C's in CHG context: 162764
Total unmethylated C's in CHH context: 247570
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.0%
C methylated in CHG context: 65.8%
C methylated in CHH context: 80.2%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to completeSequences with no alignments under any condition: 1308222
Sequences did not map uniquely: 82468
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51003 ((converted) top strand)
CT/GA: 48096 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 01489790 reads; of these:
1489790 (100.00%) were unpaired; of these:
1361839 (91.41%) aligned 0 times
59237 (3.98%) aligned exactly 1 time
68714 (4.61%) aligned >1 times
8.59% overall alignment rate
1489790 reads; of these:
1489790 (100.00%) were unpaired; of these:
1364747 (91.61%) aligned 0 times
57793 (3.88%) aligned exactly 1 time
67250 (4.51%) aligned >1 times
8.39% overall alignment rateProcessed 1489790 sequences in total
Successfully deleted the temporary file 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 1489790
Number of alignments with a unique best hit from the different alignments: 99765
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2130133
Total methylated C's in CpG context: 354366
Total methylated C's in CHG context: 316536
Total methylated C's in CHH context: 1006043
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 39745
Total unmethylated C's in CHG context: 165120
Total unmethylated C's in CHH context: 248323
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 89.9%
C methylated in CHG context: 65.7%
C methylated in CHH context: 80.2%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 1307514
Sequences did not map uniquely: 82511
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 51396 ((converted) top strand)
CT/GA: 48369 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9 Now merging BAM files 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam into >>> 2112_lane1_ACAGTG_L001_R1_trimmed_bismark_bt2.bam <<<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed_bismark_bt2_SE_report.txt
Now merging temporary reports 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ACAGTG/2112_lane1_ACAGTG_L001_R1_trimmed_bismark_bt2_SE_report.txt <<<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 13408105
Number of alignments with a unique best hit from the different alignments: 893397
Mapping efficiency: 6.7%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 19063048
Total methylated C's in CpG context: 3176333
Total methylated C's in CHG context: 2824859
Total methylated C's in CHH context: 8997540
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 354463
Total unmethylated C's in CHG context: 1478354
Total unmethylated C's in CHH context: 2231499
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.0%
C methylated in CHG context: 65.6%
C methylated in CHH context: 80.1%
C methylated in Unknown context (CN or CHN): 100.0%
Deleting temporary report files...Sequences with no alignments under any condition: 11771006
Sequences did not map uniquely: 743702
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 458865 ((converted) top strand)
CT/GA: 434532 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_ACAGTG_L001_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt
====================
Bismark run complete
====================
Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: 2112_lane1_ATCACG_R1_trimmed.fq
Files to be analysed:
2112_lane1_ATCACG_R1_trimmed.fqFastQ format specifiedLibrary is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Created output directory /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/!
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing 2112_lane1_ATCACG_R1_trimmed.fq for PID: 0 and offset 1
Using the subset file >2112_lane1_ATCACG_R1_trimmed.fq.temp.1< as new in-file (instead of >2112_lane1_ATCACG_R1_trimmed.fq<)
Input file is in FastQ format
Finished subdividing 2112_lane1_ATCACG_R1_trimmed.fq for PID: 8066 and offset 9
Using the subset file >2112_lane1_ATCACG_R1_trimmed.fq.temp.9< as new in-file (instead of >2112_lane1_ATCACG_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ATCACG_R1_trimmed.fq.temp.1 to 2112_lane1_ATCACG_R1_trimmed.fq.temp.1_C_to_T.fastq
Writing a C -> T converted version of the input file 2112_lane1_ATCACG_R1_trimmed.fq.temp.9 to 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_C_to_T.fastq
Finished subdividing 2112_lane1_ATCACG_R1_trimmed.fq for PID: 0 and offset 8
Using the subset file >2112_lane1_ATCACG_R1_trimmed.fq.temp.8< as new in-file (instead of >2112_lane1_ATCACG_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ATCACG_R1_trimmed.fq.temp.8 to 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_C_to_T.fastq
Finished subdividing 2112_lane1_ATCACG_R1_trimmed.fq for PID: 0 and offset 7
Using the subset file >2112_lane1_ATCACG_R1_trimmed.fq.temp.7< as new in-file (instead of >2112_lane1_ATCACG_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ATCACG_R1_trimmed.fq.temp.7 to 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_C_to_T.fastq
Finished subdividing 2112_lane1_ATCACG_R1_trimmed.fq for PID: 0 and offset 5
Using the subset file >2112_lane1_ATCACG_R1_trimmed.fq.temp.5< as new in-file (instead of >2112_lane1_ATCACG_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ATCACG_R1_trimmed.fq.temp.5 to 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_C_to_T.fastq
Finished subdividing 2112_lane1_ATCACG_R1_trimmed.fq for PID: 0 and offset 3
Using the subset file >2112_lane1_ATCACG_R1_trimmed.fq.temp.3< as new in-file (instead of >2112_lane1_ATCACG_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ATCACG_R1_trimmed.fq.temp.3 to 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_C_to_T.fastq
Finished subdividing 2112_lane1_ATCACG_R1_trimmed.fq for PID: 0 and offset 6
Using the subset file >2112_lane1_ATCACG_R1_trimmed.fq.temp.6< as new in-file (instead of >2112_lane1_ATCACG_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ATCACG_R1_trimmed.fq.temp.6 to 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_C_to_T.fastq
Finished subdividing 2112_lane1_ATCACG_R1_trimmed.fq for PID: 0 and offset 4
Using the subset file >2112_lane1_ATCACG_R1_trimmed.fq.temp.4< as new in-file (instead of >2112_lane1_ATCACG_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ATCACG_R1_trimmed.fq.temp.4 to 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_C_to_T.fastq
Finished subdividing 2112_lane1_ATCACG_R1_trimmed.fq for PID: 0 and offset 2
Using the subset file >2112_lane1_ATCACG_R1_trimmed.fq.temp.2< as new in-file (instead of >2112_lane1_ATCACG_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_ATCACG_R1_trimmed.fq.temp.2 to 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_C_to_T.fastq
Created C -> T converted version of the FastQ file 2112_lane1_ATCACG_R1_trimmed.fq.temp.3 (3293070 sequences in total)
Input file is 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ATCACG_R1_trimmed.fq.temp.5 (3293070 sequences in total)
Input file is 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ATCACG_R1_trimmed.fq.temp.4 (3293070 sequences in total)
Input file is 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ATCACG_R1_trimmed.fq.temp.7 (3293070 sequences in total)
Input file is 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ATCACG_R1_trimmed.fq.temp.2 (3293070 sequences in total)
Input file is 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ATCACG_R1_trimmed.fq.temp.9 (3293070 sequences in total)
Input file is 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ATCACG_R1_trimmed.fq.temp.6 (3293070 sequences in total)
Input file is 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ATCACG_R1_trimmed.fq.temp.1 (3293071 sequences in total)
Input file is 2112_lane1_ATCACG_R1_trimmed.fq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_ATCACG_R1_trimmed.fq.temp.8 (3293070 sequences in total)
Input file is 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1297:2201_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTTATAATTAATGATGTAAAATAGTGTTTTTTAATTTTTAAATTTTGTAATATAAAAATATTTTAAGATTAATTAATAATATTAGAATTATTAAAAATATT @CCFFFFFGGHGHHJICEHJJJJJCDHIIIIIJGJJJJJIJIJJJJJJIHIGHCFGIIHJJJJJIGHEGIGEFHDCEHGHFHHHG@HFFFFFB>>CEECDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1393:2105_1:N:0:ATCACG 4 * 0 0 * * 0 0 AATTATTTTATAAAAAAATAAAAATAAATTATTAATTAATTATTTATTTATATATATATTTTAATAATTTATAATAAAATATAAAATAATTTATTTTTAT ??@DDFFFGBDHDGGIBHGFGIIIDIGIIIDIIIGHDHIIGII>BDGCEGHHGIGCEAD@CEEHHFHF?BACC>>@CBBDDDDDCCCABDBCAACCDCDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1222:2147_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTATATAAATATTAAATTAATTTTTTTTATAAATTTATATATTATTGAATATTATTATTTAAATAATAAAATTATTGATTTTTTTATGTTTTTAAAATTTT @@<D?DB;BFDFB@;F@CEDGIIGEHHIGGG=8CFIII>FHII>GIE06B?FD=BG:BHGC7=@GA>7@>7AHHC3?235<@?BCBB=BBBBB<AA::@CA YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1486:2076_1:N:0:ATCACG 4 * 0 0 * * 0 0 GANTGGAAGAGTATATGTTTGAATTTTAGTTATATTATGATTTTGTATGTTGTTTTTTGTTTGAAA @@#4ADDDHHHHGJGIJIIIJIIJIIIJJGHFHIJJIIJHIIFIJGHIIIJJJIGGGIJIGGH=>E YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1460:2184_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATAATTTGTTGAATATTGATTAGAAAAAGAGGGAAATTTGGATTATAGTATTTATGGGTGTTTAAATTATTTTAATTTAGGAAAATTTTTATGTTATTTT @@?DFFFFDHDHDIIICHIFIBEFGGIGIIIH=DHHCH@HIEHFHGIGHBFHFGEGHG@7;:A@CECDDFDCDCC;CEDEACC@?CCC:>CDDCDFCDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1406:2157_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTTTATTAATTAATTATAAATTAAATTATTTTTAATATGATAATATTATATAAAATAAAATATTTATTTTTATTAATTATATTAATTTTTATTTATTAATT CCCFFFFFHHGHHJIIJIJJJJIJJJJJJJIJJJJJJJJIJJJJJJJFIJJIGIJJJJE@C@GHGDHIIHJIHHG?EHFFFFFFFEEEEEEDDDFDDDDD? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1346:2124_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATTTTTAATTAAAAAAAATTTTTATTTTTATTTATGTTATTGAAAATGAAAATAAATTTAAAAATATAATTATTTTGTTTGTTTATTTGTTTATTTATTT CCCFFFFDFHHHHJJJJJJJIJJJJJJJJJJJJJJJJHIJJJJGIJJJJHHHFFFEEECCCECDDDDDDDCDDDDCCDDDDDABDDEDDDDDDDEDDDEDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1442:2090_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATTTTTAATATGAAAATATAATTGATGTAAATGTATTTGTTATTGATTATTAAAATATATTATTAATAAAATATAATTATAAATTAAATAATAAAAATAT CCCFFFFDDFHHFEHIIIICHIBDFHIE:BFGHG>HBED@F88;DHE<?DCEEEDACC;@;CC;>CC>@>CCDC@>@CCDDDCDE@>CDDDDDDA?ADDB@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1477:2106_1:N:0:ATCACG 4 * 0 0 * * 0 0 GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTAGGGTTAGGGGTAGGGTTAGGGTTAGGGTTAGGGTTAGGG =?@DDDBDHAADFEE2:AFGHFDGGGGC:???D:?3))B09)?BG8(BBB;8A4(;==;=;7;',';;5-5(5?<?B@BAB5188<B9<?BCB YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1393:2105_1:N:0:ATCACG 4 * 0 0 * * 0 0 AATTATTTTATAAAAAAATAAAAATAAATTATTAATTAATTATTTATTTATATATATATTTTAATAATTTATAATAAAATATAAAATAATTTATTTTTAT ??@DDFFFGBDHDGGIBHGFGIIIDIGIIIDIIIGHDHIIGII>BDGCEGHHGIGCEAD@CEEHHFHF?BACC>>@CBBDDDDDCCCABDBCAACCDCDD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1222:2147_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTATATAAATATTAAATTAATTTTTTTTATAAATTTATATATTATTGAATATTATTATTTAAATAATAAAATTATTGATTTTTTTATGTTTTTAAAATTTT @@<D?DB;BFDFB@;F@CEDGIIGEHHIGGG=8CFIII>FHII>GIE06B?FD=BG:BHGC7=@GA>7@>7AHHC3?235<@?BCBB=BBBBB<AA::@CA YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1442:2090_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATTTTTAATATGAAAATATAATTGATGTAAATGTATTTGTTATTGATTATTAAAATATATTATTAATAAAATATAATTATAAATTAAATAATAAAAATAT CCCFFFFDDFHHFEHIIIICHIBDFHIE:BFGHG>HBED@F88;DHE<?DCEEEDACC;@;CC;>CC>@>CCDC@>@CCDDDCDE@>CDDDDDDA?ADDB@ YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1460:2184_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATAATTTGTTGAATATTGATTAGAAAAAGAGGGAAATTTGGATTATAGTATTTATGGGTGTTTAAATTATTTTAATTTAGGAAAATTTTTATGTTATTTT @@?DFFFFDHDHDIIICHIFIBEFGGIGIIIH=DHHCH@HIEHFHGIGHBFHFGEGHG@7;:A@CECDDFDCDCC;CEDEACC@?CCC:>CDDCDFCDDDD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1486:2076_1:N:0:ATCACG 4 * 0 0 * * 0 0 GANTGGAAGAGTATATGTTTGAATTTTAGTTATATTATGATTTTGTATGTTGTTTTTTGTTTGAAA @@#4ADDDHHHHGJGIJIIIJIIJIIIJJGHFHIJJIIJHIIFIJGHIIIJJJIGGGIJIGGH=>E YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1477:2106_1:N:0:ATCACG 4 * 0 0 * * 0 0 GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTAGGGTTAGGGGTAGGGTTAGGGTTAGGGTTAGGGTTAGGG =?@DDDBDHAADFEE2:AFGHFDGGGGC:???D:?3))B09)?BG8(BBB;8A4(;==;=;7;',';;5-5(5?<?B@BAB5188<B9<?BCB YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1346:2124_1:N:0:ATCACG 4 * 0 0 * * 0 0 TATTTTTAATTAAAAAAAATTTTTATTTTTATTTATGTTATTGAAAATGAAAATAAATTTAAAAATATAATTATTTTGTTTGTTTATTTGTTTATTTATTT CCCFFFFDFHHHHJJJJJJJIJJJJJJJJJJJJJJJJHIJJJJGIJJJJHHHFFFEEECCCECDDDDDDDCDDDDCCDDDDDABDDEDDDDDDDEDDDEDD YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1406:2157_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTTTATTAATTAATTATAAATTAAATTATTTTTAATATGATAATATTATATAAAATAAAATATTTATTTTTATTAATTATATTAATTTTTATTTATTAATT CCCFFFFFHHGHHJIIJIJJJJIJJJJJJJIJJJJJJJJIJJJJJJJFIJJIGIJJJJE@C@GHGDHIIHJIHHG?EHFFFFFFFEEEEEEDDDFDDDDD? YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1297:2201_1:N:0:ATCACG 4 * 0 0 * * 0 0 TTTATAATTAATGATGTAAAATAGTGTTTTTTAATTTTTAAATTTTGTAATATAAAAATATTTTAAGATTAATTAATAATATTAGAATTATTAAAAATATT @CCFFFFFGGHGHHJICEHJJJJJCDHIIIIIJGJJJJJIJIJJJJJJIHIGHCFGIIHJJJJJIGHEGIGEFHDCEHGHFHHHG@HFFFFFB>>CEECDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.5_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.4_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.8_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.3_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.2_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.1_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.6_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.7_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.9_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_ATCACG_R1_trimmed.fq.temp.8
Reading in the sequence file 2112_lane1_ATCACG_R1_trimmed.fq.temp.4
Reading in the sequence file 2112_lane1_ATCACG_R1_trimmed.fq.temp.5
Reading in the sequence file 2112_lane1_ATCACG_R1_trimmed.fq.temp.3
Reading in the sequence file 2112_lane1_ATCACG_R1_trimmed.fq.temp.1
Reading in the sequence file 2112_lane1_ATCACG_R1_trimmed.fq.temp.2
Reading in the sequence file 2112_lane1_ATCACG_R1_trimmed.fq.temp.6
Reading in the sequence file 2112_lane1_ATCACG_R1_trimmed.fq.temp.7
Reading in the sequence file 2112_lane1_ATCACG_R1_trimmed.fq.temp.9
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Chromosomal sequence could not be extracted for HWI-ST0747:461:C64YUACXX:1:1314:6069:93808_1:N:0:ATCACG KV918297.1 2638025
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Chromosomal sequence could not be extracted for HWI-ST0747:461:C64YUACXX:1:2216:8056:13122_1:N:0:ATCACG KV918391.1 1
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3044071 (92.44%) aligned 0 times
160819 (4.88%) aligned exactly 1 time
88180 (2.68%) aligned >1 times
7.56% overall alignment rate
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3044215 (92.44%) aligned 0 times
160550 (4.88%) aligned exactly 1 time
88305 (2.68%) aligned >1 times
7.56% overall alignment rate
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3049494 (92.60%) aligned 0 times
157602 (4.79%) aligned exactly 1 time
85974 (2.61%) aligned >1 times
7.40% overall alignment rateProcessed 3293070 sequences in total3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3048075 (92.56%) aligned 0 times
158528 (4.81%) aligned exactly 1 time
86467 (2.63%) aligned >1 times
7.44% overall alignment rate
Successfully deleted the temporary file 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3293070
Number of alignments with a unique best hit from the different alignments: 273494
Mapping efficiency: 8.3%Sequences with no alignments under any condition: 2904133
Sequences did not map uniquely: 115443
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 140227 ((converted) top strand)
CT/GA: 133267 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5396838
Total methylated C's in CpG context: 676388
Total methylated C's in CHG context: 857915
Total methylated C's in CHH context: 2885747
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 99340
Total unmethylated C's in CHG context: 277978
Total unmethylated C's in CHH context: 599470
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.2%
C methylated in CHG context: 75.5%
C methylated in CHH context: 82.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Processed 3293070 sequences in total
Successfully deleted the temporary file 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3293070
Number of alignments with a unique best hit from the different alignments: 274164
Mapping efficiency: 8.3%Sequences with no alignments under any condition: 2903086
Sequences did not map uniquely: 115820
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 139891 ((converted) top strand)
CT/GA: 134273 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5407224
Total methylated C's in CpG context: 676546
Total methylated C's in CHG context: 859827
Total methylated C's in CHH context: 2896104
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 98873
Total unmethylated C's in CHG context: 277765
Total unmethylated C's in CHH context: 598109
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.2%
C methylated in CHG context: 75.6%
C methylated in CHH context: 82.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3044191 (92.44%) aligned 0 times
160529 (4.87%) aligned exactly 1 time
88350 (2.68%) aligned >1 times
7.56% overall alignment rate
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3048975 (92.59%) aligned 0 times
158016 (4.80%) aligned exactly 1 time
86079 (2.61%) aligned >1 times
7.41% overall alignment rateProcessed 3293070 sequences in total
Successfully deleted the temporary file 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3293070
Number of alignments with a unique best hit from the different alignments: 273697
Mapping efficiency: 8.3%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5400894
Total methylated C's in CpG context: 674276
Total methylated C's in CHG context: 859370
Total methylated C's in CHH context: 2895065
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 99829
Total unmethylated C's in CHG context: 276015
Total unmethylated C's in CHH context: 596339
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.1%
C methylated in CHG context: 75.7%
C methylated in CHH context: 82.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2903821
Sequences did not map uniquely: 115552
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 139926 ((converted) top strand)
CT/GA: 133771 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3044178 (92.44%) aligned 0 times
160568 (4.88%) aligned exactly 1 time
88324 (2.68%) aligned >1 times
7.56% overall alignment rate
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3048449 (92.57%) aligned 0 times
158288 (4.81%) aligned exactly 1 time
86333 (2.62%) aligned >1 times
7.43% overall alignment rateProcessed 3293070 sequences in total
Successfully deleted the temporary file 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3293070
Number of alignments with a unique best hit from the different alignments: 273769
Mapping efficiency: 8.3%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5406239
Total methylated C's in CpG context: 675921
Total methylated C's in CHG context: 859038
Total methylated C's in CHH context: 2892420
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 98676
Total unmethylated C's in CHG context: 278003
Total unmethylated C's in CHH context: 602181
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.3%
C methylated in CHG context: 75.6%
C methylated in CHH context: 82.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to completeSequences with no alignments under any condition: 2903551
Sequences did not map uniquely: 115750
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 139914 ((converted) top strand)
CT/GA: 133855 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3045073 (92.47%) aligned 0 times
159577 (4.85%) aligned exactly 1 time
88420 (2.69%) aligned >1 times
7.53% overall alignment rate
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3049302 (92.60%) aligned 0 times
157764 (4.79%) aligned exactly 1 time
86004 (2.61%) aligned >1 times
7.40% overall alignment rateProcessed 3293070 sequences in total
Successfully deleted the temporary file 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3293070
Number of alignments with a unique best hit from the different alignments: 272882
Mapping efficiency: 8.3%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5383641
Total methylated C's in CpG context: 673298
Total methylated C's in CHG context: 854131
Total methylated C's in CHH context: 2887479
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 98378
Total unmethylated C's in CHG context: 275677
Total unmethylated C's in CHH context: 594678
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.3%
C methylated in CHG context: 75.6%
C methylated in CHH context: 82.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2904764
Sequences did not map uniquely: 115424
Sequences which were discarded because genomic sequence could not be extracted: 2
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 139228 ((converted) top strand)
CT/GA: 133652 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3043629 (92.43%) aligned 0 times
160585 (4.88%) aligned exactly 1 time
88856 (2.70%) aligned >1 times
7.57% overall alignment rate
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3049079 (92.59%) aligned 0 times
157641 (4.79%) aligned exactly 1 time
86350 (2.62%) aligned >1 times
7.41% overall alignment rateProcessed 3293070 sequences in total
Successfully deleted the temporary file 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3293070
Number of alignments with a unique best hit from the different alignments: 273908
Mapping efficiency: 8.3%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5409082
Total methylated C's in CpG context: 675635
Total methylated C's in CHG context: 859380
Total methylated C's in CHH context: 2894950
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 99791
Total unmethylated C's in CHG context: 278294
Total unmethylated C's in CHH context: 601032
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.1%
C methylated in CHG context: 75.5%
C methylated in CHH context: 82.8%
C methylated in Unknown context (CN or CHN): 100.0%Sequences with no alignments under any condition: 2903428
Sequences did not map uniquely: 115734
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 140411 ((converted) top strand)
CT/GA: 133497 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3044759 (92.46%) aligned 0 times
160192 (4.86%) aligned exactly 1 time
88119 (2.68%) aligned >1 times
7.54% overall alignment rate
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3049847 (92.61%) aligned 0 times
156851 (4.76%) aligned exactly 1 time
86372 (2.62%) aligned >1 times
7.39% overall alignment rateProcessed 3293070 sequences in total
Successfully deleted the temporary file 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3293070
Number of alignments with a unique best hit from the different alignments: 272474
Mapping efficiency: 8.3%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5374440
Total methylated C's in CpG context: 672008
Total methylated C's in CHG context: 854008
Total methylated C's in CHH context: 2880201
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 98851
Total unmethylated C's in CHG context: 275048
Total unmethylated C's in CHH context: 594324
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.2%
C methylated in CHG context: 75.6%
C methylated in CHH context: 82.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2905091
Sequences did not map uniquely: 115505
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 139632 ((converted) top strand)
CT/GA: 132842 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3044233 (92.44%) aligned 0 times
160367 (4.87%) aligned exactly 1 time
88470 (2.69%) aligned >1 times
7.56% overall alignment rate
3293070 reads; of these:
3293070 (100.00%) were unpaired; of these:
3048962 (92.59%) aligned 0 times
157637 (4.79%) aligned exactly 1 time
86471 (2.63%) aligned >1 times
7.41% overall alignment rateProcessed 3293070 sequences in total
Successfully deleted the temporary file 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3293070
Number of alignments with a unique best hit from the different alignments: 273278
Mapping efficiency: 8.3%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5390077
Total methylated C's in CpG context: 675230
Total methylated C's in CHG context: 859216
Total methylated C's in CHH context: 2889880
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 98873
Total unmethylated C's in CHG context: 274453
Total unmethylated C's in CHH context: 592425
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.2%
C methylated in CHG context: 75.8%
C methylated in CHH context: 83.0%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2903943
Sequences did not map uniquely: 115849
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 139861 ((converted) top strand)
CT/GA: 133417 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03293071 reads; of these:
3293071 (100.00%) were unpaired; of these:
3043693 (92.43%) aligned 0 times
160589 (4.88%) aligned exactly 1 time
88789 (2.70%) aligned >1 times
7.57% overall alignment rate
3293071 reads; of these:
3293071 (100.00%) were unpaired; of these:
3049246 (92.60%) aligned 0 times
157557 (4.78%) aligned exactly 1 time
86268 (2.62%) aligned >1 times
7.40% overall alignment rateProcessed 3293071 sequences in total
Successfully deleted the temporary file 2112_lane1_ATCACG_R1_trimmed.fq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3293071
Number of alignments with a unique best hit from the different alignments: 272933
Mapping efficiency: 8.3%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 5394031
Total methylated C's in CpG context: 673679
Total methylated C's in CHG context: 857494
Total methylated C's in CHH context: 2894656
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 97337
Total unmethylated C's in CHG context: 275010
Total unmethylated C's in CHH context: 595855
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.4%
C methylated in CHG context: 75.7%
C methylated in CHH context: 82.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2904105
Sequences did not map uniquely: 116033
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 139953 ((converted) top strand)
CT/GA: 132980 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_ATCACG_R1_trimmed.fq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...2112_lane1_ATCACG_R1_trimmed.fq.temp.2 2112_lane1_ATCACG_R1_trimmed.fq.temp.3 2112_lane1_ATCACG_R1_trimmed.fq.temp.4 2112_lane1_ATCACG_R1_trimmed.fq.temp.5 2112_lane1_ATCACG_R1_trimmed.fq.temp.6 2112_lane1_ATCACG_R1_trimmed.fq.temp.7 2112_lane1_ATCACG_R1_trimmed.fq.temp.8 2112_lane1_ATCACG_R1_trimmed.fq.temp.9 Now merging BAM files 2112_lane1_ATCACG_R1_trimmed.fq.temp.1_bismark_bt2.bam 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_bismark_bt2.bam 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_bismark_bt2.bam 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_bismark_bt2.bam 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_bismark_bt2.bam 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_bismark_bt2.bam 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_bismark_bt2.bam 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_bismark_bt2.bam 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_bismark_bt2.bam into >>> 2112_lane1_ATCACG_R1_trimmed_bismark_bt2.bam <<<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.1_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_bismark_bt2.bam <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed.fq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed_bismark_bt2_SE_report.txt
Now merging temporary reports 2112_lane1_ATCACG_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_ATCACG/2112_lane1_ATCACG_R1_trimmed_bismark_bt2_SE_report.txt <<<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 29637631
Number of alignments with a unique best hit from the different alignments: 2460599
Mapping efficiency: 8.3%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 48562466
Total methylated C's in CpG context: 6072981
Total methylated C's in CHG context: 7720379
Total methylated C's in CHH context: 26016502
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 889948
Total unmethylated C's in CHG context: 2488243
Total unmethylated C's in CHH context: 5374413
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 87.2%
C methylated in CHG context: 75.6%
C methylated in CHH context: 82.9%
C methylated in Unknown context (CN or CHN): 100.0%
Deleting temporary report files...
====================
Bismark run complete
====================Sequences with no alignments under any condition: 26135922
Sequences did not map uniquely: 1041110
Sequences which were discarded because genomic sequence could not be extracted: 2
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 1259043 ((converted) top strand)
CT/GA: 1201554 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_ATCACG_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_ATCACG_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'FastQ format specifiedReference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: 2112_lane1_CAGATC_R1_trimmed.fq
Files to be analysed:
2112_lane1_CAGATC_R1_trimmed.fq
Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Created output directory /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/!
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing 2112_lane1_CAGATC_R1_trimmed.fq for PID: 0 and offset 6
Using the subset file >2112_lane1_CAGATC_R1_trimmed.fq.temp.6< as new in-file (instead of >2112_lane1_CAGATC_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_CAGATC_R1_trimmed.fq.temp.6 to 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_C_to_T.fastq
Finished subdividing 2112_lane1_CAGATC_R1_trimmed.fq for PID: 0 and offset 2
Using the subset file >2112_lane1_CAGATC_R1_trimmed.fq.temp.2< as new in-file (instead of >2112_lane1_CAGATC_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_CAGATC_R1_trimmed.fq.temp.2 to 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_C_to_T.fastq
Finished subdividing 2112_lane1_CAGATC_R1_trimmed.fq for PID: 0 and offset 4
Using the subset file >2112_lane1_CAGATC_R1_trimmed.fq.temp.4< as new in-file (instead of >2112_lane1_CAGATC_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_CAGATC_R1_trimmed.fq.temp.4 to 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_C_to_T.fastq
Finished subdividing 2112_lane1_CAGATC_R1_trimmed.fq for PID: 0 and offset 1
Using the subset file >2112_lane1_CAGATC_R1_trimmed.fq.temp.1< as new in-file (instead of >2112_lane1_CAGATC_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_CAGATC_R1_trimmed.fq.temp.1 to 2112_lane1_CAGATC_R1_trimmed.fq.temp.1_C_to_T.fastq
Finished subdividing 2112_lane1_CAGATC_R1_trimmed.fq for PID: 0 and offset 8
Using the subset file >2112_lane1_CAGATC_R1_trimmed.fq.temp.8< as new in-file (instead of >2112_lane1_CAGATC_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_CAGATC_R1_trimmed.fq.temp.8 to 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_C_to_T.fastq
Finished subdividing 2112_lane1_CAGATC_R1_trimmed.fq for PID: 10577 and offset 9
Using the subset file >2112_lane1_CAGATC_R1_trimmed.fq.temp.9< as new in-file (instead of >2112_lane1_CAGATC_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_CAGATC_R1_trimmed.fq.temp.9 to 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_C_to_T.fastq
Finished subdividing 2112_lane1_CAGATC_R1_trimmed.fq for PID: 0 and offset 7
Using the subset file >2112_lane1_CAGATC_R1_trimmed.fq.temp.7< as new in-file (instead of >2112_lane1_CAGATC_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_CAGATC_R1_trimmed.fq.temp.7 to 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_C_to_T.fastq
Finished subdividing 2112_lane1_CAGATC_R1_trimmed.fq for PID: 0 and offset 5
Using the subset file >2112_lane1_CAGATC_R1_trimmed.fq.temp.5< as new in-file (instead of >2112_lane1_CAGATC_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_CAGATC_R1_trimmed.fq.temp.5 to 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_C_to_T.fastq
Finished subdividing 2112_lane1_CAGATC_R1_trimmed.fq for PID: 0 and offset 3
Using the subset file >2112_lane1_CAGATC_R1_trimmed.fq.temp.3< as new in-file (instead of >2112_lane1_CAGATC_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_CAGATC_R1_trimmed.fq.temp.3 to 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_C_to_T.fastq
Created C -> T converted version of the FastQ file 2112_lane1_CAGATC_R1_trimmed.fq.temp.2 (3701059 sequences in total)
Input file is 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1357:2076_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTNTGTAGATGTTATTTTGAAATATTTTATAGAGGTGTGAATTTTTTTAGGTTTTGAGTTTTTTTTTTTGGAGAAGATAGAAATTAAATTAAAAAATAGT @@#4=ABDHFFFHIIIIIG@ECHIIGIIIIIIGGGDFBFGHCHGGGGIIIHIIIIIAB5;CEHHCEEFFDCD@;255:ACC@CCDB<BDDDDCCCBB(9? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file 2112_lane1_CAGATC_R1_trimmed.fq.temp.4 (3701059 sequences in total)
Input file is 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_CAGATC_R1_trimmed.fq.temp.1 (3701059 sequences in total)
Input file is 2112_lane1_CAGATC_R1_trimmed.fq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1357:2076_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTNTGTAGATGTTATTTTGAAATATTTTATAGAGGTGTGAATTTTTTTAGGTTTTGAGTTTTTTTTTTTGGAGAAGATAGAAATTAAATTAAAAAATAGT @@#4=ABDHFFFHIIIIIG@ECHIIGIIIIIIGGGDFBFGHCHGGGGIIIHIIIIIAB5;CEHHCEEFFDCD@;255:ACC@CCDB<BDDDDCCCBB(9? YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.2_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1464:2079_1:N:0:CAGATC 4 * 0 0 * * 0 0 TGNTTTTTTTAATTATTTTAAAATTGAAAATATTAAAATATATTTTAATATTAATTTTATTGATAAAATTATAAATTATATATATATATTTTTTTTTATTT ==#4=BDDAFDHAHGIGIJIIGJGIIBHIIIGIIGIIG<G<@@GIIIIIIJJIJIIJJJJJGIHFFFDA>CADED@CBDDBD:ADDEE>@ACCDDCDDCCD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1170:2189_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTTTGTAAATTATAAAAAAATTTATTTTTTATGTAAAAAAATTAAAAAAATAAATAAAAATTGTGAATTTTTAAAAAAATTTATTATATTATTTTTTTTTT @?@DDDDFG>FDHIGIGHHGGEHGGII@GHIIHIGGGEIGGIIHHIHGFC>CCDDDBB?BBCBDD;@BBD:A9A828>BBCDDDDEEDCCD@CDCCCCCCC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file 2112_lane1_CAGATC_R1_trimmed.fq.temp.8 (3701059 sequences in total)
Input file is 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1464:2079_1:N:0:CAGATC 4 * 0 0 * * 0 0 TGNTTTTTTTAATTATTTTAAAATTGAAAATATTAAAATATATTTTAATATTAATTTTATTGATAAAATTATAAATTATATATATATATTTTTTTTTATTT ==#4=BDDAFDHAHGIGIJIIGJGIIBHIIIGIIGIIG<G<@@GIIIIIIJJIJIIJJJJJGIHFFFDA>CADED@CBDDBD:ADDEE>@ACCDDCDDCCD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.4_bismark_bt2.bam <<<
Created C -> T converted version of the FastQ file 2112_lane1_CAGATC_R1_trimmed.fq.temp.9 (3701059 sequences in total)
Input file is 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Reading in the sequence file 2112_lane1_CAGATC_R1_trimmed.fq.temp.2
Created C -> T converted version of the FastQ file 2112_lane1_CAGATC_R1_trimmed.fq.temp.6 (3701059 sequences in total)
Input file is 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1170:2189_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTTTGTAAATTATAAAAAAATTTATTTTTTATGTAAAAAAATTAAAAAAATAAATAAAAATTGTGAATTTTTAAAAAAATTTATTATATTATTTTTTTTTT @?@DDDDFG>FDHIGIGHHGGEHGGII@GHIIHIGGGEIGGIIHHIHGFC>CCDDDBB?BBCBDD;@BBD:A9A828>BBCDDDDEEDCCD@CDCCCCCCC YT:Z:UU
Created C -> T converted version of the FastQ file 2112_lane1_CAGATC_R1_trimmed.fq.temp.7 (3701059 sequences in total)
Input file is 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.1_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1494:2179_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTTTTTTTTTATTTAATTAATTATAATTTTTAATAAATATTTAAAATTGTGATTAAAATATTGTTTTTTTGATTTTTAAAATTTGTAATT 1=BDDDFFHHHHHJJJJJJJJJIJJJJJJJJJJJJJJJJJIJJJJJJJJJJIGIEHIIJIHHHFFDDEEDBBBDD@CCDDDEDDDDBBDE YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file 2112_lane1_CAGATC_R1_trimmed.fq.temp.5 (3701059 sequences in total)
Input file is 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1422:2188_1:N:0:CAGATC 4 * 0 0 * * 0 0 AATAAATTATAAATAAATGGGTAATATATTTTTATTATATAATAATTGTATAATTTTTGTTGTTGATAAATGTTTTGATTTTGTTTAATTTTATAAAATTT @@<DDDFFHHHHHJJJJJJIIJJIIJIDHGEGHIJIJJGJIIJJJJJJJJJJFIIEIJEEHFADDBBDDDDDCDD<BBDDDDBDDDBDDDDDDDDCEDCDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file 2112_lane1_CAGATC_R1_trimmed.fq.temp.3 (3701059 sequences in total)
Input file is 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Reading in the sequence file 2112_lane1_CAGATC_R1_trimmed.fq.temp.4
Reading in the sequence file 2112_lane1_CAGATC_R1_trimmed.fq.temp.1
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1391:2128_1:N:0:CAGATC 4 * 0 0 * * 0 0 TGTGATTTTTTGTTATTAATTAATGATTTTGTTAAAAATTGATGTGTTGGATGAGGAGAAGTGGTTTAATATGTTTGGTATGTTTGTTAAGGATTGGTTT @<@?DDDDHDFH<GEGIIIIIIIIIGHAGHG@GFHDHGH>GAFEHG@HII@EHHHHDDBDC>CC?=;ACDEC@C>5:<CCCB<?B9<BB9AC<ACBB>AA YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1494:2179_1:N:0:CAGATC 4 * 0 0 * * 0 0 TTTTTTTTTTATTTAATTAATTATAATTTTTAATAAATATTTAAAATTGTGATTAAAATATTGTTTTTTTGATTTTTAAAATTTGTAATT 1=BDDDFFHHHHHJJJJJJJJJIJJJJJJJJJJJJJJJJJIJJJJJJJJJJIGIEHIIJIHHHFFDDEEDBBBDD@CCDDDEDDDDBBDE YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.8_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1323:2145_1:N:0:CAGATC 4 * 0 0 * * 0 0 GTTTGTTTGTTTATGGTTTGATTTGTTTTTTAGGGTTGTTTGGTATAGGTATGTTGTTTGTTTGTTTATGATTTATT CCCFFDFFGFHHHGHIAFGIFHEIIHHIJJJHGGDFHIFCHHIFCFGGICFGGCGCGHHIEEHE?CDFEDCCDEC6@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1271:2088_1:N:0:CAGATC 4 * 0 0 * * 0 0 GGTTGGTTGTTTGAATTTTAGTTGTGATAGATTTAAGTTGTTAAAATAGGTAGTGATAGTTTTATTGTTAAATGTTTGGTAATAGGTATGTTGTTTGTTTG =?:ABDA;FCFHFGGGHHIFGDHHHIFIIJGIJIHCGFGHIGGDDEGHHI??B?EBDFD8BFCFGHHFEFFHHCC=DAE?CAEHH=BDDFFDE@CCC@BC? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1422:2188_1:N:0:CAGATC 4 * 0 0 * * 0 0 AATAAATTATAAATAAATGGGTAATATATTTTTATTATATAATAATTGTATAATTTTTGTTGTTGATAAATGTTTTGATTTTGTTTAATTTTATAAAATTT @@<DDDFFHHHHHJJJJJJIIJJIIJIDHGEGHIJIJJGJIIJJJJJJJJJJFIIEIJEEHFADDBBDDDDDCDD<BBDDDDBDDDBDDDDDDDDCEDCDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.9_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1311:2076_1:N:0:CAGATC 4 * 0 0 * * 0 0 TANATATTTTAATAAAATAATAATATATAAATTATTATTGTATATATATTTTAATAAAATAATAATATATAAATTATTATAATATATATATTTAAATAAA @?#4ADDDGHHHHJIIJJJIJJJJJIJIJHIJJJJJIJJIHHGIJJJJJJJJIJGIJIJGHHHFHGHHFFFFFEECCEEDDCDCDDDDDDDDDCADCCB< YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Reading in the sequence file 2112_lane1_CAGATC_R1_trimmed.fq.temp.8
Reading in the sequence file 2112_lane1_CAGATC_R1_trimmed.fq.temp.9
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1391:2128_1:N:0:CAGATC 4 * 0 0 * * 0 0 TGTGATTTTTTGTTATTAATTAATGATTTTGTTAAAAATTGATGTGTTGGATGAGGAGAAGTGGTTTAATATGTTTGGTATGTTTGTTAAGGATTGGTTT @<@?DDDDHDFH<GEGIIIIIIIIIGHAGHG@GFHDHGH>GAFEHG@HII@EHHHHDDBDC>CC?=;ACDEC@C>5:<CCCB<?B9<BB9AC<ACBB>AA YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.6_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1323:2145_1:N:0:CAGATC 4 * 0 0 * * 0 0 GTTTGTTTGTTTATGGTTTGATTTGTTTTTTAGGGTTGTTTGGTATAGGTATGTTGTTTGTTTGTTTATGATTTATT CCCFFDFFGFHHHGHIAFGIFHEIIHHIJJJHGGDFHIFCHHIFCFGGICFGGCGCGHHIEEHE?CDFEDCCDEC6@ YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.7_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1271:2088_1:N:0:CAGATC 4 * 0 0 * * 0 0 GGTTGGTTGTTTGAATTTTAGTTGTGATAGATTTAAGTTGTTAAAATAGGTAGTGATAGTTTTATTGTTAAATGTTTGGTAATAGGTATGTTGTTTGTTTG =?:ABDA;FCFHFGGGHHIFGDHHHIFIIJGIJIHCGFGHIGGDDEGHHI??B?EBDFD8BFCFGHHFEFFHHCC=DAE?CAEHH=BDDFFDE@CCC@BC? YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.5_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_CAGATC_R1_trimmed.fq.temp.6
Reading in the sequence file 2112_lane1_CAGATC_R1_trimmed.fq.temp.7
Reading in the sequence file 2112_lane1_CAGATC_R1_trimmed.fq.temp.5
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1311:2076_1:N:0:CAGATC 4 * 0 0 * * 0 0 TANATATTTTAATAAAATAATAATATATAAATTATTATTGTATATATATTTTAATAAAATAATAATATATAAATTATTATAATATATATATTTAAATAAA @?#4ADDDGHHHHJIIJJJIJJJJJIJIJHIJJJJJIJJIHHGIJJJJJJJJIJGIJIJGHHHFHGHHFFFFFEECCEEDDCDCDDDDDDDDDCADCCB< YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.3_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_CAGATC_R1_trimmed.fq.temp.3
Chromosomal sequence could not be extracted for HWI-ST0747:461:C64YUACXX:1:1105:2199:83108_1:N:0:CAGATC KV918245.1 4832786
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
Processed 3000000 sequences so far
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3469962 (93.76%) aligned 0 times
131623 (3.56%) aligned exactly 1 time
99474 (2.69%) aligned >1 times
6.24% overall alignment rate
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3474442 (93.88%) aligned 0 times
129338 (3.49%) aligned exactly 1 time
97279 (2.63%) aligned >1 times
6.12% overall alignment rateProcessed 3701059 sequences in total
Successfully deleted the temporary file 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3701059
Number of alignments with a unique best hit from the different alignments: 223646
Mapping efficiency: 6.0%Sequences with no alignments under any condition: 3354390
Sequences did not map uniquely: 123023
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 114617 ((converted) top strand)
CT/GA: 109029 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4595409
Total methylated C's in CpG context: 677025
Total methylated C's in CHG context: 776586
Total methylated C's in CHH context: 2464109
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 70238
Total unmethylated C's in CHG context: 215540
Total unmethylated C's in CHH context: 391911
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.6%
C methylated in CHG context: 78.3%
C methylated in CHH context: 86.3%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3473764 (93.86%) aligned 0 times
129700 (3.50%) aligned exactly 1 time
97595 (2.64%) aligned >1 times
6.14% overall alignment rate
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3468327 (93.71%) aligned 0 times
132698 (3.59%) aligned exactly 1 time
100034 (2.70%) aligned >1 times
6.29% overall alignment rateProcessed 3701059 sequences in total
Successfully deleted the temporary file 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3701059
Number of alignments with a unique best hit from the different alignments: 224089
Mapping efficiency: 6.1%Sequences with no alignments under any condition: 3353086
Sequences did not map uniquely: 123884
Sequences which were discarded because genomic sequence could not be extracted: 1
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 115326 ((converted) top strand)
CT/GA: 108762 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4609761
Total methylated C's in CpG context: 678396
Total methylated C's in CHG context: 776686
Total methylated C's in CHH context: 2484704
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 69027
Total unmethylated C's in CHG context: 213336
Total unmethylated C's in CHH context: 387612
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.8%
C methylated in CHG context: 78.5%
C methylated in CHH context: 86.5%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3469881 (93.75%) aligned 0 times
132035 (3.57%) aligned exactly 1 time
99143 (2.68%) aligned >1 times
6.25% overall alignment rate
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3474172 (93.87%) aligned 0 times
129689 (3.50%) aligned exactly 1 time
97198 (2.63%) aligned >1 times
6.13% overall alignment rateProcessed 3701059 sequences in total
Successfully deleted the temporary file 2112_lane1_CAGATC_R1_trimmed.fq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3701059
Number of alignments with a unique best hit from the different alignments: 223743
Mapping efficiency: 6.0%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4607157
Total methylated C's in CpG context: 676938
Total methylated C's in CHG context: 776153
Total methylated C's in CHH context: 2479635
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 69108
Total unmethylated C's in CHG context: 214315
Total unmethylated C's in CHH context: 391008
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.4%
C methylated in CHH context: 86.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3354421
Sequences did not map uniquely: 122895
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 114675 ((converted) top strand)
CT/GA: 109068 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3468647 (93.72%) aligned 0 times
132617 (3.58%) aligned exactly 1 time
99795 (2.70%) aligned >1 times
6.28% overall alignment rate
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3474293 (93.87%) aligned 0 times
129433 (3.50%) aligned exactly 1 time
97333 (2.63%) aligned >1 times
6.13% overall alignment rateProcessed 3701059 sequences in total
Successfully deleted the temporary file 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3701059
Number of alignments with a unique best hit from the different alignments: 223725
Mapping efficiency: 6.0%Sequences with no alignments under any condition: 3353666
Sequences did not map uniquely: 123668
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 115118 ((converted) top strand)
CT/GA: 108607 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4604545
Total methylated C's in CpG context: 679444
Total methylated C's in CHG context: 776090
Total methylated C's in CHH context: 2477682
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 69909
Total unmethylated C's in CHG context: 213084
Total unmethylated C's in CHH context: 388336
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.5%
C methylated in CHH context: 86.5%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3473645 (93.86%) aligned 0 times
129657 (3.50%) aligned exactly 1 time
97757 (2.64%) aligned >1 times
6.14% overall alignment rate
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3469454 (93.74%) aligned 0 times
131781 (3.56%) aligned exactly 1 time
99824 (2.70%) aligned >1 times
6.26% overall alignment rate
37010593701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3468717 (93.72%) aligned 0 times
132258 (3.57%) aligned exactly 1 time
100084 (2.70%) aligned >1 times
6.28% overall alignment rate
reads; of these:
3701059 (100.00%) were unpaired; of these:
3473829 (93.86%) aligned 0 times
129787 (3.51%) aligned exactly 1 time
97443 (2.63%) aligned >1 times
6.14% overall alignment rateProcessed 3701059 sequences in total
Processed 3701059 sequences in total
Successfully deleted the temporary file 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3701059
Number of alignments with a unique best hit from the different alignments: 223827
Mapping efficiency: 6.0%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4610126
Total methylated C's in CpG context: 679151
Total methylated C's in CHG context: 779715
Total methylated C's in CHH context: 2482709
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 68820
Total unmethylated C's in CHG context: 212204
Total unmethylated C's in CHH context: 387527
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.8%
C methylated in CHG context: 78.6%
C methylated in CHH context: 86.5%
C methylated in Unknown context (CN or CHN): 100.0%Sequences with no alignments under any condition: 3353231
Sequences did not map uniquely: 124001
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 114800 ((converted) top strand)
CT/GA: 109027 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
Successfully deleted the temporary file 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3701059
Number of alignments with a unique best hit from the different alignments: 223845
Mapping efficiency: 6.0%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4607522
Total methylated C's in CpG context: 677316
Total methylated C's in CHG context: 777760
Total methylated C's in CHH context: 2480346
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 69828
Total unmethylated C's in CHG context: 212917
Total unmethylated C's in CHH context: 389355
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.5%
C methylated in CHH context: 86.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3353986
Sequences did not map uniquely: 123228
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 114698 ((converted) top strand)
CT/GA: 109147 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3469514 (93.74%) aligned 0 times
131773 (3.56%) aligned exactly 1 time
99772 (2.70%) aligned >1 times
6.26% overall alignment rate
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3473352 (93.85%) aligned 0 times
130337 (3.52%) aligned exactly 1 time
97370 (2.63%) aligned >1 times
6.15% overall alignment rateProcessed 3701059 sequences in total
Sequences with no alignments under any condition: 3353652
Sequences did not map uniquely: 123320
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 114560 ((converted) top strand)
CT/GA: 109527 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
Successfully deleted the temporary file 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3701059
Number of alignments with a unique best hit from the different alignments: 224087
Mapping efficiency: 6.1%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4613412
Total methylated C's in CpG context: 679796
Total methylated C's in CHG context: 777992
Total methylated C's in CHH context: 2481575
Total methylated C's in Unknown context: 2
Total unmethylated C's in CpG context: 68724
Total unmethylated C's in CHG context: 214577
Total unmethylated C's in CHH context: 390748
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.8%
C methylated in CHG context: 78.4%
C methylated in CHH context: 86.4%
C methylated in Unknown context (CN or CHN): 100.0%
Now waiting for all child processes to complete
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3469693 (93.75%) aligned 0 times
131874 (3.56%) aligned exactly 1 time
99492 (2.69%) aligned >1 times
6.25% overall alignment rate
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3474573 (93.88%) aligned 0 times
129251 (3.49%) aligned exactly 1 time
97235 (2.63%) aligned >1 times
6.12% overall alignment rateProcessed 3701059 sequences in total
Successfully deleted the temporary file 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3701059
Number of alignments with a unique best hit from the different alignments: 223569
Mapping efficiency: 6.0%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4601905
Total methylated C's in CpG context: 675783
Total methylated C's in CHG context: 776596
Total methylated C's in CHH context: 2476672
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 69133
Total unmethylated C's in CHG context: 212857
Total unmethylated C's in CHH context: 390864
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.5%
C methylated in CHH context: 86.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3354542
Sequences did not map uniquely: 122948
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 114749 ((converted) top strand)
CT/GA: 108820 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 03701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3468705 (93.72%) aligned 0 times
132483 (3.58%) aligned exactly 1 time
99871 (2.70%) aligned >1 times
6.28% overall alignment rate
3701059 reads; of these:
3701059 (100.00%) were unpaired; of these:
3473987 (93.86%) aligned 0 times
129521 (3.50%) aligned exactly 1 time
97551 (2.64%) aligned >1 times
6.14% overall alignment rateProcessed 3701059 sequences in total
Successfully deleted the temporary file 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 3701059
Number of alignments with a unique best hit from the different alignments: 223688
Mapping efficiency: 6.0%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 4600061
Total methylated C's in CpG context: 678077
Total methylated C's in CHG context: 776803
Total methylated C's in CHH context: 2471923
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 69544
Total unmethylated C's in CHG context: 213613
Total unmethylated C's in CHH context: 390101
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.4%
C methylated in CHH context: 86.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 3353711
Sequences did not map uniquely: 123660
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 115092 ((converted) top strand)
CT/GA: 108596 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_CAGATC_R1_trimmed.fq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...2112_lane1_CAGATC_R1_trimmed.fq.temp.2 2112_lane1_CAGATC_R1_trimmed.fq.temp.3 2112_lane1_CAGATC_R1_trimmed.fq.temp.4 2112_lane1_CAGATC_R1_trimmed.fq.temp.5 2112_lane1_CAGATC_R1_trimmed.fq.temp.6 2112_lane1_CAGATC_R1_trimmed.fq.temp.7 2112_lane1_CAGATC_R1_trimmed.fq.temp.8 2112_lane1_CAGATC_R1_trimmed.fq.temp.9 Now merging BAM files 2112_lane1_CAGATC_R1_trimmed.fq.temp.1_bismark_bt2.bam 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_bismark_bt2.bam 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_bismark_bt2.bam 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_bismark_bt2.bam 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_bismark_bt2.bam 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_bismark_bt2.bam 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_bismark_bt2.bam 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_bismark_bt2.bam 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_bismark_bt2.bam into >>> 2112_lane1_CAGATC_R1_trimmed_bismark_bt2.bam <<<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.1_bismark_bt2.bam <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_bismark_bt2.bam <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_bismark_bt2.bam <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_bismark_bt2.bam <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_bismark_bt2.bam <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_bismark_bt2.bam <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_bismark_bt2.bam <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_bismark_bt2.bam <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed.fq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed_bismark_bt2_SE_report.txt
Now merging temporary reports 2112_lane1_CAGATC_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_CAGATC/2112_lane1_CAGATC_R1_trimmed_bismark_bt2_SE_report.txt <<<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 33309531
Number of alignments with a unique best hit from the different alignments: 2014219
Mapping efficiency: 6.0%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 41449898
Total methylated C's in CpG context: 6101926
Total methylated C's in CHG context: 6994381
Total methylated C's in CHH context: 22299355
Total methylated C's in Unknown context: 3
Total unmethylated C's in CpG context: 624331
Total unmethylated C's in CHG context: 1922443
Total unmethylated C's in CHH context: 3507462
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 90.7%
C methylated in CHG context: 78.4%
C methylated in CHH context: 86.4%
C methylated in Unknown context (CN or CHN): 100.0%
Deleting temporary report files...Sequences with no alignments under any condition: 30184685
Sequences did not map uniquely: 1110627
Sequences which were discarded because genomic sequence could not be extracted: 1
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 1033635 ((converted) top strand)
CT/GA: 980583 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_CAGATC_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_CAGATC_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt
====================
Bismark run complete
====================
Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'FastQ format specifiedMapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: 2112_lane1_GCCAAT_L001_R1_trimmed.fq
Files to be analysed:
2112_lane1_GCCAAT_L001_R1_trimmed.fq
Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Created output directory /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/!
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing 2112_lane1_GCCAAT_L001_R1_trimmed.fq for PID: 12411 and offset 9
Using the subset file >2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9< as new in-file (instead of >2112_lane1_GCCAAT_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9 to 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_C_to_T.fastq
Finished subdividing 2112_lane1_GCCAAT_L001_R1_trimmed.fq for PID: 0 and offset 4
Using the subset file >2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4< as new in-file (instead of >2112_lane1_GCCAAT_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4 to 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_C_to_T.fastq
Finished subdividing 2112_lane1_GCCAAT_L001_R1_trimmed.fq for PID: 0 and offset 2
Using the subset file >2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2< as new in-file (instead of >2112_lane1_GCCAAT_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2 to 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_C_to_T.fastq
Finished subdividing 2112_lane1_GCCAAT_L001_R1_trimmed.fq for PID: 0 and offset 6
Using the subset file >2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6< as new in-file (instead of >2112_lane1_GCCAAT_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6 to 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_C_to_T.fastq
Finished subdividing 2112_lane1_GCCAAT_L001_R1_trimmed.fq for PID: 0 and offset 1
Using the subset file >2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1< as new in-file (instead of >2112_lane1_GCCAAT_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1 to 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_C_to_T.fastq
Finished subdividing 2112_lane1_GCCAAT_L001_R1_trimmed.fq for PID: 0 and offset 8
Using the subset file >2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8< as new in-file (instead of >2112_lane1_GCCAAT_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8 to 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_C_to_T.fastq
Finished subdividing 2112_lane1_GCCAAT_L001_R1_trimmed.fq for PID: 0 and offset 5
Using the subset file >2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5< as new in-file (instead of >2112_lane1_GCCAAT_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5 to 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_C_to_T.fastq
Finished subdividing 2112_lane1_GCCAAT_L001_R1_trimmed.fq for PID: 0 and offset 7
Using the subset file >2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7< as new in-file (instead of >2112_lane1_GCCAAT_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7 to 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_C_to_T.fastq
Finished subdividing 2112_lane1_GCCAAT_L001_R1_trimmed.fq for PID: 0 and offset 3
Using the subset file >2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3< as new in-file (instead of >2112_lane1_GCCAAT_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3 to 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_C_to_T.fastq
Created C -> T converted version of the FastQ file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6 (2431767 sequences in total)
Input file is 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4 (2431767 sequences in total)
Input file is 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1 (2431767 sequences in total)
Input file is 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2 (2431767 sequences in total)
Input file is 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5 (2431767 sequences in total)
Input file is 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7 (2431767 sequences in total)
Input file is 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9 (2431766 sequences in total)
Input file is 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8 (2431767 sequences in total)
Input file is 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3 (2431767 sequences in total)
Input file is 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1480:2235_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTATAAATATTATAATTTTATAATAATTAAAATTATTAATTTTATAAATATTATAATTTTATAATAATTATTTTATAAATATTATAATTTTATAATAAT @@BDDEDEFHHHHEHIGHIJJIJJIIJIFGIEAHIIGGGHIGIHGGGEAGIEHG<EGHGEGI@EHGEIGGHGGHF;CBA@ABABDCCACDDDDCCCCCACD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1244:2170_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTAATTTTAATTTTTAAAATTTTAATTTTAATTTTAATATTAAAATTTTATTTTTAATATTTAAATTTTAAAATTTTAATATTAATTTTAATATAAATA @@@FFFFFHHFH?GHIHIIDHAFHIIICGGHGHIDHB;DHIIA39?DBBFHGFG=F;CCEGIHHGFHEDFDECCC>CCCCCCCA?CC9ABCBCCC>CCCC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1123:2118_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTATTTATTTTGATTATTTATATTATATGTATTTATAATTATTGTTTTGAATTTTTTGTAATTATAAAATTTGAATTTTAATATATTTTAATTAATTGTT @@@?BDDDF?FFDF@@GH>HIGGIIIGHF?DD=D9BGGIFB?C1BFHIFA';BBDCCC>9;BB@B<??BBACB(98?CCCCCCCCDCDC>CBC@CCB<>B YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1209:2236_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTGATTATTAAAAATTTAATAAATAAAATATATTTATTTATAATTATTTAAAATTATTATTAATTAATAAAAAATAAATTTTTATAAAATTTTATTTTT @@?FFDFFHFHHHIG@GFHC@HGFHHECD>FGGGIIGIIIIGGGGDG=FGIDBCGGIJIJGGGGIJHFEHF3?D;9@ACCCCCDDCDC>;CDDDDCDCDFD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1199:2076_1:N:0:GCCAAT 4 * 0 0 * * 0 0 GTNTATTTTTAGAGTGGTTTTTTTGGTATGATTTTTTTGTATTATTATGATATTGTTGTATATTTAGGTTGGAGGAGGTATTTTGGAAAAGAAT CC#4ADDFHHGHHHIFHHIJJJJJJJHGJJJJJJJIJJJJJJIIHIIJJIJGIJIJJIIIIFIJJIIJ=DGF?CHEBFCDBEDDDD;<?CA?AC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1217:2174_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTTTTGTTTTATTTAATTTTTAAAAAAATTTTATTTTTTATTTGTTAAATTATATAATTTTATTTTTTTATTTAAAAAAATATATATTATTTTTATT @1?DDDDD<:DFHIIIFH>IHIBHIIDHIEGEGHIIGIGHIGGGGFGG=4=CHHIIID)7-;4;5?DE19;55-;;@C<ABB2:>CCC<<<28A@CC@A YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1195:2123_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TGGTTGTAATAAATTGGATTGAGTAAAGAGTTATTGTGGAAATGAGAAATATAAAGTTTGGTGGTAATTAAATATTGTTAGTTTAGTGTGAGAGTGTGAA CC@FFFFFHHHHHJJHHGIIJIJJJJIIGIGIHHGIGIJGIGGIJGFDGGIJIIIJIJIIJFCH;DHGHHEFFFF?BDDDB@CCEDFDDDDC5@:@>CCA YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1731:2078_1:N:0:GCCAAT 4 * 0 0 * * 0 0 AANAAATTATAAATAAATGGGTAATATATTTATATTTTTTTTATTTTTAAAATTTATTTTTATATATTTTATTAAAATTTAATAATATTTATTTTATAAA CC#4ADDFHFHHHJIJJIJGIJGIIJJIIJIJIHIIJIIJJJJIJJJJIIEBAHGIIJIIJJJHHHHFFFFEEDD?BDCDCCEDDDDDDDDDDDDDCDCC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1376:2154_1:N:0:GCCAAT 4 * 0 0 * * 0 0 GTTTTGAAATATTAATTGATTAAAATTTAGATAAATTTTGATTATATATATTTTAAATTAAATTATAAAAATATAAATAATAATAATTTGATAATTTAAA @@@=DDFFHHHHHJGIJGJIIGHJJIGIIJIDIJJJHIGIJJBIJFIGIIIJJJJGFHEHFDFDCEEECDB((-;555>:(;>5;(5:;&295-@C4@CC YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1480:2235_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTATAAATATTATAATTTTATAATAATTAAAATTATTAATTTTATAAATATTATAATTTTATAATAATTATTTTATAAATATTATAATTTTATAATAAT @@BDDEDEFHHHHEHIGHIJJIJJIIJIFGIEAHIIGGGHIGIHGGGEAGIEHG<EGHGEGI@EHGEIGGHGGHF;CBA@ABABDCCACDDDDCCCCCACD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1244:2170_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTAATTTTAATTTTTAAAATTTTAATTTTAATTTTAATATTAAAATTTTATTTTTAATATTTAAATTTTAAAATTTTAATATTAATTTTAATATAAATA @@@FFFFFHHFH?GHIHIIDHAFHIIICGGHGHIDHB;DHIIA39?DBBFHGFG=F;CCEGIHHGFHEDFDECCC>CCCCCCCA?CC9ABCBCCC>CCCC YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1123:2118_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTATTTATTTTGATTATTTATATTATATGTATTTATAATTATTGTTTTGAATTTTTTGTAATTATAAAATTTGAATTTTAATATATTTTAATTAATTGTT @@@?BDDDF?FFDF@@GH>HIGGIIIGHF?DD=D9BGGIFB?C1BFHIFA';BBDCCC>9;BB@B<??BBACB(98?CCCCCCCCDCDC>CBC@CCB<>B YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1209:2236_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTGATTATTAAAAATTTAATAAATAAAATATATTTATTTATAATTATTTAAAATTATTATTAATTAATAAAAAATAAATTTTTATAAAATTTTATTTTT @@?FFDFFHFHHHIG@GFHC@HGFHHECD>FGGGIIGIIIIGGGGDG=FGIDBCGGIJIJGGGGIJHFEHF3?D;9@ACCCCCDDCDC>;CDDDDCDCDFD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1217:2174_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TTTTTTTGTTTTATTTAATTTTTAAAAAAATTTTATTTTTTATTTGTTAAATTATATAATTTTATTTTTTTATTTAAAAAAATATATATTATTTTTATT @1?DDDDD<:DFHIIIFH>IHIBHIIDHIEGEGHIIGIGHIGGGGFGG=4=CHHIIID)7-;4;5?DE19;55-;;@C<ABB2:>CCC<<<28A@CC@A YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1199:2076_1:N:0:GCCAAT 4 * 0 0 * * 0 0 GTNTATTTTTAGAGTGGTTTTTTTGGTATGATTTTTTTGTATTATTATGATATTGTTGTATATTTAGGTTGGAGGAGGTATTTTGGAAAAGAAT CC#4ADDFHHGHHHIFHHIJJJJJJJHGJJJJJJJIJJJJJJIIHIIJJIJGIJIJJIIIIFIJJIIJ=DGF?CHEBFCDBEDDDD;<?CA?AC YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1731:2078_1:N:0:GCCAAT 4 * 0 0 * * 0 0 AANAAATTATAAATAAATGGGTAATATATTTATATTTTTTTTATTTTTAAAATTTATTTTTATATATTTTATTAAAATTTAATAATATTTATTTTATAAA CC#4ADDFHFHHHJIJJIJGIJGIIJJIIJIJIHIIJIIJJJJIJJJJIIEBAHGIIJIIJJJHHHHFFFFEEDD?BDCDCCEDDDDDDDDDDDDDCDCC YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1195:2123_1:N:0:GCCAAT 4 * 0 0 * * 0 0 TGGTTGTAATAAATTGGATTGAGTAAAGAGTTATTGTGGAAATGAGAAATATAAAGTTTGGTGGTAATTAAATATTGTTAGTTTAGTGTGAGAGTGTGAA CC@FFFFFHHHHHJJHHGIIJIJJJJIIGIGIHHGIGIJGIGGIJGFDGGIJIIIJIJIIJFCH;DHGHHEFFFF?BDDDB@CCEDFDDDDC5@:@>CCA YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1376:2154_1:N:0:GCCAAT 4 * 0 0 * * 0 0 GTTTTGAAATATTAATTGATTAAAATTTAGATAAATTTTGATTATATATATTTTAAATTAAATTATAAAAATATAAATAATAATAATTTGATAATTTAAA @@@=DDFFHHHHHJGIJGJIIGHJJIGIIJIDIJJJHIGIJJBIJFIGIIIJJJJGFHEHFDFDCEEECDB((-;555>:(;>5;(5:;&295-@C4@CC YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8
Reading in the sequence file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4
Reading in the sequence file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2
Reading in the sequence file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6
Reading in the sequence file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5
Reading in the sequence file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1
Reading in the sequence file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9
Reading in the sequence file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3
Reading in the sequence file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Chromosomal sequence could not be extracted for HWI-ST0747:461:C64YUACXX:1:2112:20486:87614_1:N:0:GCCAAT KV918245.1 4832786
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2369179 (97.43%) aligned 0 times
37258 (1.53%) aligned exactly 1 time
25330 (1.04%) aligned >1 times
2.57% overall alignment rate
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2371134 (97.51%) aligned 0 times
36470 (1.50%) aligned exactly 1 time
24163 (0.99%) aligned >1 times
2.49% overall alignment rateProcessed 2431767 sequences in total
Successfully deleted the temporary file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2431767
Number of alignments with a unique best hit from the different alignments: 62653
Mapping efficiency: 2.6%Sequences with no alignments under any condition: 2336067
Sequences did not map uniquely: 33047
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 32265 ((converted) top strand)
CT/GA: 30388 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1208096
Total methylated C's in CpG context: 150902
Total methylated C's in CHG context: 184437
Total methylated C's in CHH context: 669478
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 28535
Total unmethylated C's in CHG context: 54884
Total unmethylated C's in CHH context: 119860
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.1%
C methylated in CHG context: 77.1%
C methylated in CHH context: 84.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
2431766 reads; of these:
2431766 (100.00%) were unpaired; of these:
2369320 (97.43%) aligned 0 times
37293 (1.53%) aligned exactly 1 time
25153 (1.03%) aligned >1 times
2.57% overall alignment rate
2431766 reads; of these:
2431766 (100.00%) were unpaired; of these:
2371478 (97.52%) aligned 0 times
36187 (1.49%) aligned exactly 1 time
24101 (0.99%) aligned >1 times
2.48% overall alignment rateProcessed 2431766 sequences in total
Successfully deleted the temporary file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2431766
Number of alignments with a unique best hit from the different alignments: 62400
Mapping efficiency: 2.6%Sequences with no alignments under any condition: 2336492
Sequences did not map uniquely: 32874
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 32180 ((converted) top strand)
CT/GA: 30220 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1204656
Total methylated C's in CpG context: 151290
Total methylated C's in CHG context: 184717
Total methylated C's in CHH context: 666886
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 27532
Total unmethylated C's in CHG context: 54444
Total unmethylated C's in CHH context: 119787
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.6%
C methylated in CHG context: 77.2%
C methylated in CHH context: 84.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to complete
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2369798 (97.45%) aligned 0 times
36998 (1.52%) aligned exactly 1 time
24971 (1.03%) aligned >1 times
2.55% overall alignment rate
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2371188 (97.51%) aligned 0 times
36395 (1.50%) aligned exactly 1 time
24184 (0.99%) aligned >1 times
2.49% overall alignment rateProcessed 2431767 sequences in total
Successfully deleted the temporary file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2431767
Number of alignments with a unique best hit from the different alignments: 62372
Mapping efficiency: 2.6%Sequences with no alignments under any condition: 2336615
Sequences did not map uniquely: 32780
Sequences which were discarded because genomic sequence could not be extracted: 1
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 31790 ((converted) top strand)
CT/GA: 30581 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1205482
Total methylated C's in CpG context: 150073
Total methylated C's in CHG context: 183803
Total methylated C's in CHH context: 668374
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 28641
Total unmethylated C's in CHG context: 55149
Total unmethylated C's in CHH context: 119442
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.0%
C methylated in CHG context: 76.9%
C methylated in CHH context: 84.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2369255 (97.43%) aligned 0 times
37062 (1.52%) aligned exactly 1 time
25450 (1.05%) aligned >1 times
2.57% overall alignment rate
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2371017 (97.50%) aligned 0 times
36441 (1.50%) aligned exactly 1 time
24309 (1.00%) aligned >1 times
2.50% overall alignment rateProcessed 2431767 sequences in total
Successfully deleted the temporary file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2431767
Number of alignments with a unique best hit from the different alignments: 62529
Mapping efficiency: 2.6%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1207464
Total methylated C's in CpG context: 151574
Total methylated C's in CHG context: 184598
Total methylated C's in CHH context: 667855
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 27927
Total unmethylated C's in CHG context: 54865
Total unmethylated C's in CHH context: 120645
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.4%
C methylated in CHG context: 77.1%
C methylated in CHH context: 84.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2336105
Sequences did not map uniquely: 33133
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 32028 ((converted) top strand)
CT/GA: 30501 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2369220 (97.43%) aligned 0 times
37260 (1.53%) aligned exactly 1 time
25287 (1.04%) aligned >1 times
2.57% overall alignment rate
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2371206 (97.51%) aligned 0 times
36375 (1.50%) aligned exactly 1 time
24186 (0.99%) aligned >1 times
2.49% overall alignment rateProcessed 2431767 sequences in total
Successfully deleted the temporary file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2431767
Number of alignments with a unique best hit from the different alignments: 62646
Mapping efficiency: 2.6%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1209487
Total methylated C's in CpG context: 151468
Total methylated C's in CHG context: 186033
Total methylated C's in CHH context: 669043
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 28494
Total unmethylated C's in CHG context: 54976
Total unmethylated C's in CHH context: 119473
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.2%
C methylated in CHG context: 77.2%
C methylated in CHH context: 84.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2336177
Sequences did not map uniquely: 32944
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 32221 ((converted) top strand)
CT/GA: 30425 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2369065 (97.42%) aligned 0 times
37318 (1.53%) aligned exactly 1 time
25384 (1.04%) aligned >1 times
2.58% overall alignment rate
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2370684 (97.49%) aligned 0 times
36606 (1.51%) aligned exactly 1 time
24477 (1.01%) aligned >1 times
2.51% overall alignment rateProcessed 2431767 sequences in total
Successfully deleted the temporary file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2431767
Number of alignments with a unique best hit from the different alignments: 62626
Mapping efficiency: 2.6%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1208917
Total methylated C's in CpG context: 151577
Total methylated C's in CHG context: 185226
Total methylated C's in CHH context: 668141
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 28262
Total unmethylated C's in CHG context: 55368
Total unmethylated C's in CHH context: 120343
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.3%
C methylated in CHG context: 77.0%
C methylated in CHH context: 84.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2335827
Sequences did not map uniquely: 33314
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 31986 ((converted) top strand)
CT/GA: 30640 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2368945 (97.42%) aligned 0 times
37262 (1.53%) aligned exactly 1 time
25560 (1.05%) aligned >1 times
2.58% overall alignment rate
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2370762 (97.49%) aligned 0 times
36752 (1.51%) aligned exactly 1 time
24253 (1.00%) aligned >1 times
2.51% overall alignment rateProcessed 2431767 sequences in total
Successfully deleted the temporary file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2431767
Number of alignments with a unique best hit from the different alignments: 62917
Mapping efficiency: 2.6%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1214184
Total methylated C's in CpG context: 152283
Total methylated C's in CHG context: 187002
Total methylated C's in CHH context: 672699
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 27924
Total unmethylated C's in CHG context: 55009
Total unmethylated C's in CHH context: 119267
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.5%
C methylated in CHG context: 77.3%
C methylated in CHH context: 84.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2335666
Sequences did not map uniquely: 33184
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 32186 ((converted) top strand)
CT/GA: 30731 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2368899 (97.41%) aligned 0 times
37104 (1.53%) aligned exactly 1 time
25764 (1.06%) aligned >1 times
2.59% overall alignment rate
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2369010 (97.42%) aligned 0 times
37112 (1.53%) aligned exactly 1 time
25645 (1.05%) aligned >1 times
2.58% overall alignment rate
2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2370546 (97.48%) aligned 0 times
36799 (1.51%) aligned exactly 1 time
24422 (1.00%) aligned >1 times
2.52% overall alignment rateProcessed 2431767 sequences in total2431767 reads; of these:
2431767 (100.00%) were unpaired; of these:
2370885 (97.50%) aligned 0 times
36486 (1.50%) aligned exactly 1 time
24396 (1.00%) aligned >1 times
2.50% overall alignment rateProcessed 2431767 sequences in total
Successfully deleted the temporary file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2431767
Number of alignments with a unique best hit from the different alignments: 62663
Mapping efficiency: 2.6%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1209785
Total methylated C's in CpG context: 150478
Total methylated C's in CHG context: 184917
Total methylated C's in CHH context: 670859
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 28238
Total unmethylated C's in CHG context: 54522
Total unmethylated C's in CHH context: 120771
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.2%
C methylated in CHG context: 77.2%
C methylated in CHH context: 84.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2335550
Sequences did not map uniquely: 33554
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 31874 ((converted) top strand)
CT/GA: 30789 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
Successfully deleted the temporary file 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2431767
Number of alignments with a unique best hit from the different alignments: 62899
Mapping efficiency: 2.6%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 1216129
Total methylated C's in CpG context: 152151
Total methylated C's in CHG context: 186185
Total methylated C's in CHH context: 673750
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 28262
Total unmethylated C's in CHG context: 55061
Total unmethylated C's in CHH context: 120720
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.3%
C methylated in CHG context: 77.2%
C methylated in CHH context: 84.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2335793
Sequences did not map uniquely: 33075
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 32203 ((converted) top strand)
CT/GA: 30696 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9 Now merging BAM files 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam into >>> 2112_lane1_GCCAAT_L001_R1_trimmed_bismark_bt2.bam <<<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed_bismark_bt2_SE_report.txt
Now merging temporary reports 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_GCCAAT/2112_lane1_GCCAAT_L001_R1_trimmed_bismark_bt2_SE_report.txt <<<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 21885902
Number of alignments with a unique best hit from the different alignments: 563705
Mapping efficiency: 2.6%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 10884200
Total methylated C's in CpG context: 1361796
Total methylated C's in CHG context: 1666918
Total methylated C's in CHH context: 6027085
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 253815
Total unmethylated C's in CHG context: 494278
Total unmethylated C's in CHH context: 1080308
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.3%
C methylated in CHG context: 77.1%
C methylated in CHH context: 84.8%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Deleting temporary report files...
====================
Bismark run complete
====================Sequences with no alignments under any condition: 21024292
Sequences did not map uniquely: 297905
Sequences which were discarded because genomic sequence could not be extracted: 1
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 288733 ((converted) top strand)
CT/GA: 274971 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_GCCAAT_L001_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'FastQ format specifiedReference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: 2112_lane1_TGACCA_L001_R1_001_trimmed.fq
Files to be analysed:
2112_lane1_TGACCA_L001_R1_001_trimmed.fq
Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Created output directory /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/!
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing 2112_lane1_TGACCA_L001_R1_001_trimmed.fq for PID: 0 and offset 7
Using the subset file >2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7< as new in-file (instead of >2112_lane1_TGACCA_L001_R1_001_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7 to 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_C_to_T.fastq
Finished subdividing 2112_lane1_TGACCA_L001_R1_001_trimmed.fq for PID: 0 and offset 5
Using the subset file >2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5< as new in-file (instead of >2112_lane1_TGACCA_L001_R1_001_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5 to 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_C_to_T.fastq
Finished subdividing 2112_lane1_TGACCA_L001_R1_001_trimmed.fq for PID: 0 and offset 2
Using the subset file >2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2< as new in-file (instead of >2112_lane1_TGACCA_L001_R1_001_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2 to 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_C_to_T.fastq
Finished subdividing 2112_lane1_TGACCA_L001_R1_001_trimmed.fq for PID: 0 and offset 1
Using the subset file >2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1< as new in-file (instead of >2112_lane1_TGACCA_L001_R1_001_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1 to 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_C_to_T.fastq
Finished subdividing 2112_lane1_TGACCA_L001_R1_001_trimmed.fq for PID: 0 and offset 3
Using the subset file >2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3< as new in-file (instead of >2112_lane1_TGACCA_L001_R1_001_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3 to 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_C_to_T.fastq
Finished subdividing 2112_lane1_TGACCA_L001_R1_001_trimmed.fq for PID: 0 and offset 8
Using the subset file >2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8< as new in-file (instead of >2112_lane1_TGACCA_L001_R1_001_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8 to 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_C_to_T.fastq
Finished subdividing 2112_lane1_TGACCA_L001_R1_001_trimmed.fq for PID: 0 and offset 4
Using the subset file >2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4< as new in-file (instead of >2112_lane1_TGACCA_L001_R1_001_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4 to 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_C_to_T.fastq
Finished subdividing 2112_lane1_TGACCA_L001_R1_001_trimmed.fq for PID: 0 and offset 6
Using the subset file >2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6< as new in-file (instead of >2112_lane1_TGACCA_L001_R1_001_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6 to 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_C_to_T.fastq
Finished subdividing 2112_lane1_TGACCA_L001_R1_001_trimmed.fq for PID: 14003 and offset 9
Using the subset file >2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9< as new in-file (instead of >2112_lane1_TGACCA_L001_R1_001_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9 to 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_C_to_T.fastq
Created C -> T converted version of the FastQ file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5 (467445 sequences in total)
Input file is 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2 (467446 sequences in total)
Input file is 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8 (467445 sequences in total)
Input file is 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7 (467445 sequences in total)
Input file is 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4 (467445 sequences in total)
Input file is 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3 (467445 sequences in total)
Input file is 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1 (467446 sequences in total)
Input file is 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6 (467445 sequences in total)
Input file is 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2332:2223_1:N:0:TGACCA 4 * 0 0 * * 0 0 GGATGGAGGAGAGTTATGTTTTTTTTTTTTTTTTTTGGTTAGTTATATATATGTTTAAGAGAAAGGGGTTGGATTTTTTAATGGTTAGGAAGTATGGG CCC?DFFFHHHHHGIJJJJJJJJJIJJFJJEGICG@AE=>DEGHHEHHFFEDEEEECCCAC?CDDDDB2;BB55>4@CC@AC@CBDCDB<<<::@BDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2958:2080_1:N:0:TGACCA 4 * 0 0 * * 0 0 GANTGGAAGAGTATATGTTTGAATTTTAGTTATTGATTAATTTTGTATGTTGTTTTTTGTTTGAAAAA CC#4=DDFHHHHHIIIIIIIIIIIIIIIIIIIIIIIIGIIIIIIIAGHIIIIGIGIIIIIIIICHHHE YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2975:2083_1:N:0:TGACCA 4 * 0 0 * * 0 0 GATTTGTTGTTATAGGTTGTGTTGTTAAAATGTTGGTTATAGTAATTTTTTTTAGTTTTAATTTTATTTTTTTTTTTGTGTTTTGTTTTAATATTTGGTTG @@@DDDB:FDFHHIIGAGFEHIEGGHGIGFIGFFHFHGGHEAHFCAHHEEEE@DE@BCCCCCCCCCDCCCECCCC>CBCBBBBBCCCCCCCEACDEECCC@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1225:2225_1:N:0:TGACCA 0 MWPT01000292.1_CT_converted 742753 0 62M * 0 0 TTTTGTTGAAAATTGTATGTTTTTGTATTTTGTATAAATTAAAGTTTTTAAGTATAGATTTT ???DD??DD<3C32<:+AC?4C+<1?C18??*1??4:DD>*B*90?D<98*99?C:BC<C@C AS:i:-12 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:4A52G4 YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1818:2247_1:N:0:TGACCA 4 * 0 0 * * 0 0 GGTGTAGAGTAGTGTAGTGTAGTGTAGTGTAGTTAAGTGTATAGTAGTGTTGTTAAGTGTAGAGGAGTGTAGTGTAGTGTAGTATAGTG @@@BDDDDHAAD<A,2C?FE>ECFC:FACEHFCB<<C<B199:E94CD@:CBGCA4??D999*B(9?888/=)=/)8=@).7.===@7? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2409:2114_1:N:0:TGACCA 4 * 0 0 * * 0 0 GTTTAGGGTAATGTGTTGTAGGTGTTTGTTAATTTTATTATTATTTTGGAGGATTATATGGAGGAATATTAATGGGTTGTTTTAGGTAGGGGTTATATT @@@FFFFDHHHHHCGHHJJIJE?FCHIIJJJIJJJJJJGGIIIJIJIJIEHHHFFFFEEEEDBBBDCDDDDDDDB95>BBDDDDDC@CDBDB5<ACDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1110:2171_1:N:0:TGACCA 4 * 0 0 * * 0 0 TGTGTGTTTGTTATTGTTTGATGTATAGATATTTTTATTGATGTTTTTTGTGATGTTGTGTGATT CCCFFFDDHHHHFHIIIHIJEHIIDIGHGIII?CBDDGHIGGGIJIJFHIIIFHFBFHDHHIGED YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2840:2075_1:N:0:TGACCA 4 * 0 0 * * 0 0 GANTGGAAGAGTATATGTTTGAATTTTAGTTATTGATTAATTTTGTATGTTGTTTTTTGTTTGAAA CC#4ADDFHHHHHJJIGGIGIJJJHIIJIHIIJJJJBGHFGIGHCFHGEHFB;AHHGCEHHGC;=A YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9 (467445 sequences in total)
Input file is 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2958:2080_1:N:0:TGACCA 4 * 0 0 * * 0 0 GANTGGAAGAGTATATGTTTGAATTTTAGTTATTGATTAATTTTGTATGTTGTTTTTTGTTTGAAAAA CC#4=DDFHHHHHIIIIIIIIIIIIIIIIIIIIIIIIGIIIIIIIAGHIIIIGIGIIIIIIIICHHHE YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2975:2083_1:N:0:TGACCA 4 * 0 0 * * 0 0 GATTTGTTGTTATAGGTTGTGTTGTTAAAATGTTGGTTATAGTAATTTTTTTTAGTTTTAATTTTATTTTTTTTTTTGTGTTTTGTTTTAATATTTGGTTG @@@DDDB:FDFHHIIGAGFEHIEGGHGIGFIGFFHFHGGHEAHFCAHHEEEE@DE@BCCCCCCCCCDCCCECCCC>CBCBBBBBCCCCCCCEACDEECCC@ YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2332:2223_1:N:0:TGACCA 4 * 0 0 * * 0 0 GGATGGAGGAGAGTTATGTTTTTTTTTTTTTTTTTTGGTTAGTTATATATATGTTTAAGAGAAAGGGGTTGGATTTTTTAATGGTTAGGAAGTATGGG CCC?DFFFHHHHHGIJJJJJJJJJIJJFJJEGICG@AE=>DEGHHEHHFFEDEEEECCCAC?CDDDDB2;BB55>4@CC@AC@CBDCDB<<<::@BDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1225:2225_1:N:0:TGACCA 4 * 0 0 * * 0 0 TTTTGTTGAAAATTGTATGTTTTTGTATTTTGTATAAATTAAAGTTTTTAAGTATAGATTTT ???DD??DD<3C32<:+AC?4C+<1?C18??*1??4:DD>*B*90?D<98*99?C:BC<C@C YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1818:2247_1:N:0:TGACCA 4 * 0 0 * * 0 0 GGTGTAGAGTAGTGTAGTGTAGTGTAGTGTAGTTAAGTGTATAGTAGTGTTGTTAAGTGTAGAGGAGTGTAGTGTAGTGTAGTATAGTG @@@BDDDDHAAD<A,2C?FE>ECFC:FACEHFCB<<C<B199:E94CD@:CBGCA4??D999*B(9?888/=)=/)8=@).7.===@7? YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2409:2114_1:N:0:TGACCA 4 * 0 0 * * 0 0 GTTTAGGGTAATGTGTTGTAGGTGTTTGTTAATTTTATTATTATTTTGGAGGATTATATGGAGGAATATTAATGGGTTGTTTTAGGTAGGGGTTATATT @@@FFFFDHHHHHCGHHJJIJE?FCHIIJJJIJJJJJJGGIIIJIJIJIEHHHFFFFEEEEDBBBDCDDDDDDDB95>BBDDDDDC@CDBDB5<ACDDD YT:Z:UU
Reading in the sequence file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1110:2171_1:N:0:TGACCA 4 * 0 0 * * 0 0 TGTGTGTTTGTTATTGTTTGATGTATAGATATTTTTATTGATGTTTTTTGTGATGTTGTGTGATT CCCFFFDDHHHHFHIIIHIJEHIIDIGHGIII?CBDDGHIGGGIJIJFHIIIFHFBFHDHHIGED YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5
Reading in the sequence file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:3166:2124_1:N:0:TGACCA 4 * 0 0 * * 0 0 TTTTATTAAATATATTTAATATATAATTTAAAATTTTTTATATATTGTTATTGAAATAATGATGTTTTTTAATATTGATAATTATATAAATATGATATTT @@@FFFFFFHHHHGIJJIIJIIIEGHIGGGGIEIGGGIJIGIGIBGEHHCEHIDGGCHIJIEEBCCBDDDDDDDFCDDDDDDDDDDDDDDDDDDDDDDEE YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:2840:2075_1:N:0:TGACCA 4 * 0 0 * * 0 0 GANTGGAAGAGTATATGTTTGAATTTTAGTTATTGATTAATTTTGTATGTTGTTTTTTGTTTGAAA CC#4ADDFHHHHHJJIGGIGIJJJHIIJIHIIJJJJBGHFGIGHCFHGEHFB;AHHGCEHHGC;=A YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3
Reading in the sequence file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4
Reading in the sequence file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1
Reading in the sequence file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:3166:2124_1:N:0:TGACCA 4 * 0 0 * * 0 0 TTTTATTAAATATATTTAATATATAATTTAAAATTTTTTATATATTGTTATTGAAATAATGATGTTTTTTAATATTGATAATTATATAAATATGATATTT @@@FFFFFFHHHHGIJJIIJIIIEGHIGGGGIEIGGGIJIGIGIBGEHHCEHIDGGCHIJIEEBCCBDDDDDDDFCDDDDDDDDDDDDDDDDDDDDDDEE YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
431871 (92.39%) aligned 0 times
21692 (4.64%) aligned exactly 1 time
13882 (2.97%) aligned >1 times
7.61% overall alignment rate
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
432345 (92.49%) aligned 0 times
21362 (4.57%) aligned exactly 1 time
13738 (2.94%) aligned >1 times
7.51% overall alignment rateProcessed 467445 sequences in total
Successfully deleted the temporary file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 467445
Number of alignments with a unique best hit from the different alignments: 36946
Mapping efficiency: 7.9%Sequences with no alignments under any condition: 411936
Sequences did not map uniquely: 18563
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 18842 ((converted) top strand)
CT/GA: 18104 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 790192
Total methylated C's in CpG context: 152401
Total methylated C's in CHG context: 149802
Total methylated C's in CHH context: 386290
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 10451
Total unmethylated C's in CHG context: 41747
Total unmethylated C's in CHH context: 49501
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 78.2%
C methylated in CHH context: 88.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
432378 (92.50%) aligned 0 times
21432 (4.58%) aligned exactly 1 time
13635 (2.92%) aligned >1 times
7.50% overall alignment rate
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
431829 (92.38%) aligned 0 times
21756 (4.65%) aligned exactly 1 time
13860 (2.97%) aligned >1 times
7.62% overall alignment rateProcessed 467445 sequences in total
Successfully deleted the temporary file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 467445
Number of alignments with a unique best hit from the different alignments: 36707
Mapping efficiency: 7.9%Sequences with no alignments under any condition: 412111
Sequences did not map uniquely: 18627
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 18729 ((converted) top strand)
CT/GA: 17978 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 786215
Total methylated C's in CpG context: 151582
Total methylated C's in CHG context: 148568
Total methylated C's in CHH context: 384822
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 10481
Total unmethylated C's in CHG context: 41384
Total unmethylated C's in CHH context: 49378
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.5%
C methylated in CHG context: 78.2%
C methylated in CHH context: 88.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to complete
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
431999 (92.42%) aligned 0 times
21683 (4.64%) aligned exactly 1 time
13763 (2.94%) aligned >1 times
7.58% overall alignment rate
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
432345 (92.49%) aligned 0 times
21440 (4.59%) aligned exactly 1 time
13660 (2.92%) aligned >1 times
7.51% overall alignment rateProcessed 467445 sequences in total
Successfully deleted the temporary file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 467445
Number of alignments with a unique best hit from the different alignments: 36788
Mapping efficiency: 7.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 786373
Total methylated C's in CpG context: 152321
Total methylated C's in CHG context: 148912
Total methylated C's in CHH context: 383717
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 10454
Total unmethylated C's in CHG context: 41392
Total unmethylated C's in CHH context: 49577
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 78.2%
C methylated in CHH context: 88.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 412183
Sequences did not map uniquely: 18474
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 18756 ((converted) top strand)
CT/GA: 18032 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0467445 reads; of these:
467445 (100.00%) were unpaired; of these:
432258 (92.47%) aligned 0 times
21582 (4.62%) aligned exactly 1 time
13605 (2.91%) aligned >1 times
7.53% overall alignment rate
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
432432 (92.51%) aligned 0 times
21582 (4.62%) aligned exactly 1 time
13431 (2.87%) aligned >1 times
7.49% overall alignment rateProcessed 467445 sequences in total
Successfully deleted the temporary file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 467445
Number of alignments with a unique best hit from the different alignments: 36860
Mapping efficiency: 7.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 787492
Total methylated C's in CpG context: 152895
Total methylated C's in CHG context: 148277
Total methylated C's in CHH context: 383437
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 10472
Total unmethylated C's in CHG context: 42170
Total unmethylated C's in CHH context: 50241
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 77.9%
C methylated in CHH context: 88.4%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 412288
Sequences did not map uniquely: 18297
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 18624 ((converted) top strand)
CT/GA: 18236 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0467445 reads; of these:
467445 (100.00%) were unpaired; of these:
431834 (92.38%) aligned 0 times
21754 (4.65%) aligned exactly 1 time
13857 (2.96%) aligned >1 times
7.62% overall alignment rate
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
432684 (92.56%) aligned 0 times
21265 (4.55%) aligned exactly 1 time
13496 (2.89%) aligned >1 times
7.44% overall alignment rateProcessed 467445 sequences in total
Successfully deleted the temporary file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 467445
Number of alignments with a unique best hit from the different alignments: 36848
Mapping efficiency: 7.9%Sequences with no alignments under any condition: 412167
Sequences did not map uniquely: 18430
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 18952 ((converted) top strand)
CT/GA: 17896 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 787101
Total methylated C's in CpG context: 152028
Total methylated C's in CHG context: 149079
Total methylated C's in CHH context: 383775
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 10392
Total unmethylated C's in CHG context: 42095
Total unmethylated C's in CHH context: 49732
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 78.0%
C methylated in CHH context: 88.5%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
467446 reads; of these:
467446 (100.00%) were unpaired; of these:
431752 (92.36%) aligned 0 times
22038 (4.71%) aligned exactly 1 time
13656 (2.92%) aligned >1 times
7.64% overall alignment rate
467446 reads; of these:
467446 (100.00%) were unpaired; of these:
432545 (92.53%) aligned 0 times
21477 (4.59%) aligned exactly 1 time
13424 (2.87%) aligned >1 times
7.47% overall alignment rateProcessed 467446 sequences in total
Successfully deleted the temporary file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 467446
Number of alignments with a unique best hit from the different alignments: 37096
Mapping efficiency: 7.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 795065
Total methylated C's in CpG context: 152920
Total methylated C's in CHG context: 151070
Total methylated C's in CHH context: 389115
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 10473
Total unmethylated C's in CHG context: 41967
Total unmethylated C's in CHH context: 49520
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 78.3%
C methylated in CHH context: 88.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 412002
Sequences did not map uniquely: 18348
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 19085 ((converted) top strand)
CT/GA: 18011 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0467446 reads; of these:
467446 (100.00%) were unpaired; of these:
432000 (92.42%) aligned 0 times
21684 (4.64%) aligned exactly 1 time
13762 (2.94%) aligned >1 times
7.58% overall alignment rate
467446 reads; of these:
467446 (100.00%) were unpaired; of these:
432124 (92.44%) aligned 0 times
21565 (4.61%) aligned exactly 1 time
13757 (2.94%) aligned >1 times
7.56% overall alignment rateProcessed 467446 sequences in total
Successfully deleted the temporary file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 467446
Number of alignments with a unique best hit from the different alignments: 36683
Mapping efficiency: 7.8%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 785100
Total methylated C's in CpG context: 151275
Total methylated C's in CHG context: 150162
Total methylated C's in CHH context: 384641
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 9983
Total unmethylated C's in CHG context: 40887
Total unmethylated C's in CHH context: 48152
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.8%
C methylated in CHG context: 78.6%
C methylated in CHH context: 88.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 412051
Sequences did not map uniquely: 18712
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 18578 ((converted) top strand)
CT/GA: 18105 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0467445 reads; of these:
467445 (100.00%) were unpaired; of these:
432213 (92.46%) aligned 0 times
21627 (4.63%) aligned exactly 1 time
13605 (2.91%) aligned >1 times
7.54% overall alignment rate
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
431895 (92.39%) aligned 0 times
21829 (4.67%) aligned exactly 1 time
13721 (2.94%) aligned >1 times
7.61% overall alignment rate
467445 reads; of these:
467445 (100.00%) were unpaired; of these:
432482 (92.52%) aligned 0 times
21463 (4.59%) aligned exactly 1 time
13500 (2.89%) aligned >1 times
7.48% overall alignment rateProcessed 467445 sequences in total
Successfully deleted the temporary file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 467445
Number of alignments with a unique best hit from the different alignments: 36733
Mapping efficiency: 7.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 787475
Total methylated C's in CpG context: 151854
Total methylated C's in CHG context: 149959
Total methylated C's in CHH context: 386119
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 10354
Total unmethylated C's in CHG context: 40854
Total unmethylated C's in CHH context: 48335
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 78.6%
C methylated in CHH context: 88.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 412371
Sequences did not map uniquely: 18341
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 18660 ((converted) top strand)
CT/GA: 18073 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0467445 reads; of these:
467445 (100.00%) were unpaired; of these:
432501 (92.52%) aligned 0 times
21354 (4.57%) aligned exactly 1 time
13590 (2.91%) aligned >1 times
7.48% overall alignment rateProcessed 467445 sequences in total
Successfully deleted the temporary file 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 467445
Number of alignments with a unique best hit from the different alignments: 36834
Mapping efficiency: 7.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 789446
Total methylated C's in CpG context: 153085
Total methylated C's in CHG context: 148767
Total methylated C's in CHH context: 385371
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 10292
Total unmethylated C's in CHG context: 41991
Total unmethylated C's in CHH context: 49940
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.7%
C methylated in CHG context: 78.0%
C methylated in CHH context: 88.5%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 412117
Sequences did not map uniquely: 18494
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 18912 ((converted) top strand)
CT/GA: 17922 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9 Now merging BAM files 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_bismark_bt2.bam 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_bismark_bt2.bam 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_bismark_bt2.bam 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_bismark_bt2.bam 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_bismark_bt2.bam 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_bismark_bt2.bam 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_bismark_bt2.bam 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_bismark_bt2.bam 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_bismark_bt2.bam into >>> 2112_lane1_TGACCA_L001_R1_001_trimmed_bismark_bt2.bam <<<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed_bismark_bt2_SE_report.txt
Now merging temporary reports 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TGACCA/2112_lane1_TGACCA_L001_R1_001_trimmed_bismark_bt2_SE_report.txt <<<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 4207007
Number of alignments with a unique best hit from the different alignments: 331495
Mapping efficiency: 7.9%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 7094459
Total methylated C's in CpG context: 1370361
Total methylated C's in CHG context: 1344596
Total methylated C's in CHH context: 3467287
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 93352
Total unmethylated C's in CHG context: 374487
Total unmethylated C's in CHH context: 444376
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 93.6%
C methylated in CHG context: 78.2%
C methylated in CHH context: 88.6%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Deleting temporary report files...Sequences with no alignments under any condition: 3709226
Sequences did not map uniquely: 166286
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 169138 ((converted) top strand)
CT/GA: 162357 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_TGACCA_L001_R1_001_trimmed.fq.temp.9_bismark_bt2_SE_report.txt
====================
Bismark run complete
====================
Path to Bowtie 2 specified as: bowtie2
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is /home/srlab/Documents/C-virginica-BSSeq/genome/ (absolute path is '/home/srlab/Documents/C-virginica-BSSeq/genome/)'
Mapping set to single-end mode (user defined). File names need to be separated by commas [,] or colons [:]! Supplied file names are: 2112_lane1_TTAGGC_L001_R1_trimmed.fq
Files to be analysed:
2112_lane1_TTAGGC_L001_R1_trimmed.fqFastQ format specifiedLibrary is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Created output directory /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/!
Output will be written into the directory: /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/
Running Bismark Parallel version. Number of parallel instances to be spawned: 9
Current working directory is: /home/srlab/Documents/C-virginica-BSSeq
Now reading in and storing sequence information of the genome specified in: /home/srlab/Documents/C-virginica-BSSeq/genome/chr KV918244.1 (5562293 bp)
chr KV918245.1 (4832883 bp)
chr KV918246.1 (4378960 bp)
chr MWPT01000009.1 (3356639 bp)
chr KV918247.1 (2355263 bp)
chr KV918248.1 (3911507 bp)
chr MWPT01000017.1 (2686679 bp)
chr KV918249.1 (2829685 bp)
chr KV918250.1 (3333291 bp)
chr KV918251.1 (2850922 bp)
chr KV918252.1 (5300508 bp)
chr KV918253.1 (2652252 bp)
chr KV918254.1 (3461433 bp)
chr MWPT01000032.1 (1975305 bp)
chr KV918255.1 (2606931 bp)
chr MWPT01000041.1 (1717003 bp)
chr KV918256.1 (2582953 bp)
chr KV918257.1 (2738754 bp)
chr MWPT01000052.1 (1062419 bp)
chr KV918258.1 (1578002 bp)
chr KV918259.1 (1347034 bp)
chr KV918260.1 (684916 bp)
chr MWPT01000061.1 (509886 bp)
chr KV918261.1 (1120656 bp)
chr MWPT01000067.1 (376046 bp)
chr KV918262.1 (444482 bp)
chr MWPT01000070.1 (357480 bp)
chr MWPT01000071.1 (291238 bp)
chr KV918263.1 (1230771 bp)
chr MWPT01000527.1 (136883 bp)
chr KV918264.1 (12680670 bp)
chr KV918265.1 (2816827 bp)
chr KV918266.1 (2977081 bp)
chr MWPT01000137.1 (2796345 bp)
chr MWPT01000138.1 (2693371 bp)
chr MWPT01000139.1 (2365311 bp)
chr MWPT01000140.1 (2238563 bp)
chr MWPT01000141.1 (2207340 bp)
chr KV918267.1 (2277360 bp)
chr KV918268.1 (2822076 bp)
chr KV918269.1 (3547160 bp)
chr MWPT01000152.1 (1096595 bp)
chr KV918270.1 (2145051 bp)
chr KV918271.1 (1587102 bp)
chr MWPT01000161.1 (1425844 bp)
chr KV918272.1 (1907351 bp)
chr MWPT01000166.1 (1422582 bp)
chr KV918273.1 (1339065 bp)
chr KV918274.1 (1546923 bp)
chr KV918275.1 (1698010 bp)
chr MWPT01000175.1 (1051837 bp)
chr KV918276.1 (981967 bp)
chr MWPT01000182.1 (448202 bp)
chr KV918277.1 (917777 bp)
chr MWPT01000185.1 (839050 bp)
chr MWPT01000186.1 (724047 bp)
chr MWPT01000187.1 (682532 bp)
chr MWPT01000188.1 (392340 bp)
chr MWPT01000189.1 (356808 bp)
chr KV918278.1 (2436952 bp)
chr KV918279.1 (385926 bp)
chr KV918280.1 (1961913 bp)
chr KV918281.1 (7786243 bp)
chr MWPT01000194.1 (3534718 bp)
chr MWPT01000195.1 (3254428 bp)
chr MWPT01000196.1 (2889749 bp)
chr MWPT01000197.1 (2524072 bp)
chr MWPT01000198.1 (2141569 bp)
chr MWPT01000199.1 (2045508 bp)
chr KV918282.1 (2192831 bp)
chr KV918283.1 (3982359 bp)
chr MWPT01000205.1 (1913558 bp)
chr KV918284.1 (5938325 bp)
chr MWPT01000213.1 (1819665 bp)
chr KV918285.1 (3010866 bp)
chr MWPT01000216.1 (1543109 bp)
chr KV918286.1 (1541268 bp)
chr MWPT01000219.1 (1527358 bp)
chr MWPT01000220.1 (927761 bp)
chr KV918287.1 (1495603 bp)
chr MWPT01000225.1 (1391987 bp)
chr MWPT01000226.1 (1267255 bp)
chr MWPT01000227.1 (1262423 bp)
chr MWPT01000228.1 (1255886 bp)
chr KV918288.1 (2059602 bp)
chr MWPT01000236.1 (1098465 bp)
chr MWPT01000237.1 (1081217 bp)
chr KV918289.1 (1222516 bp)
chr MWPT01000241.1 (1057763 bp)
chr KV918290.1 (2056098 bp)
chr KV918291.1 (1857027 bp)
chr KV918292.1 (1203224 bp)
chr MWPT01000254.1 (865943 bp)
chr KV918293.1 (904861 bp)
chr MWPT01000257.1 (843307 bp)
chr MWPT01000258.1 (872954 bp)
chr KV918294.1 (1445946 bp)
chr MWPT01000261.1 (815299 bp)
chr MWPT01000262.1 (819735 bp)
chr KV918295.1 (894170 bp)
chr MWPT01000266.1 (593101 bp)
chr MWPT01000267.1 (517245 bp)
chr MWPT01000268.1 (422393 bp)
chr KV918296.1 (374206 bp)
chr MWPT01000271.1 (285735 bp)
chr KV918297.1 (2638124 bp)
chr MWPT01000132.1 (3069683 bp)
chr KV918298.1 (6258228 bp)
chr KV918299.1 (4762230 bp)
chr KV918300.1 (4909813 bp)
chr KV918301.1 (4886044 bp)
chr MWPT01000292.1 (3102771 bp)
chr KV918302.1 (4906456 bp)
chr KV918303.1 (2044046 bp)
chr MWPT01000301.1 (2550412 bp)
chr KV918304.1 (2515771 bp)
chr MWPT01000305.1 (2187399 bp)
chr KV918305.1 (5410003 bp)
chr KV918306.1 (2272750 bp)
chr MWPT01000313.1 (1775320 bp)
chr MWPT01000314.1 (1603798 bp)
chr KV918307.1 (2308754 bp)
chr KV918308.1 (1938434 bp)
chr MWPT01000320.1 (1317752 bp)
chr KV918309.1 (1352802 bp)
chr KV918310.1 (2226218 bp)
chr MWPT01000328.1 (1052579 bp)
chr KV918311.1 (923568 bp)
chr KV918312.1 (1134795 bp)
chr MWPT01000334.1 (885077 bp)
chr MWPT01000335.1 (824456 bp)
chr MWPT01000336.1 (765637 bp)
chr KV918313.1 (584168 bp)
chr KV918314.1 (944098 bp)
chr KV918315.1 (808456 bp)
chr MWPT01000343.1 (482633 bp)
chr KV918316.1 (643206 bp)
chr MWPT01000421.1 (484002 bp)
chr MWPT01000532.1 (470776 bp)
chr KV918317.1 (2074599 bp)
chr KV918318.1 (9119220 bp)
chr MWPT01000350.1 (4491256 bp)
chr MWPT01000351.1 (4187197 bp)
chr KV918319.1 (4367352 bp)
chr KV918320.1 (4548939 bp)
chr KV918321.1 (3696092 bp)
chr KV918322.1 (3948338 bp)
chr MWPT01000360.1 (2892682 bp)
chr KV918323.1 (4044222 bp)
chr MWPT01000363.1 (2689329 bp)
chr KV918324.1 (2791483 bp)
chr KV918325.1 (2940093 bp)
chr KV918326.1 (2068281 bp)
chr KV918327.1 (2465851 bp)
chr MWPT01000378.1 (748885 bp)
chr MWPT01000379.1 (589915 bp)
chr MWPT01000380.1 (554808 bp)
chr MWPT01000381.1 (489263 bp)
chr KV918328.1 (464725 bp)
chr KV918329.1 (469357 bp)
chr MWPT01000386.1 (391304 bp)
chr MWPT01000387.1 (243720 bp)
chr KV918330.1 (709582 bp)
chr KV918331.1 (1455932 bp)
chr KV918332.1 (5224090 bp)
chr KV918333.1 (10098079 bp)
chr KV918334.1 (10066667 bp)
chr KV918335.1 (6231318 bp)
chr MWPT01000396.1 (3199022 bp)
chr MWPT01000398.1 (3334036 bp)
chr MWPT01000403.1 (3473365 bp)
chr MWPT01000404.1 (3037733 bp)
chr MWPT01000405.1 (2721753 bp)
chr KV918336.1 (2171808 bp)
chr KV918337.1 (1620111 bp)
chr KV918338.1 (1605531 bp)
chr MWPT01000413.1 (509639 bp)
chr KV918339.1 (166177 bp)
chr KV918340.1 (592233 bp)
chr MWPT01000012.1 (656707 bp)
chr KV918341.1 (2281237 bp)
chr MWPT01000416.1 (3228757 bp)
chr MWPT01000417.1 (3070944 bp)
chr MWPT01000418.1 (2999364 bp)
chr KV918342.1 (2965468 bp)
chr KV918343.1 (4001099 bp)
chr KV918344.1 (2468544 bp)
chr KV918345.1 (3799038 bp)
chr MWPT01000430.1 (2027284 bp)
chr KV918346.1 (2335779 bp)
chr MWPT01000433.1 (1832700 bp)
chr KV918347.1 (1755862 bp)
chr KV918348.1 (1786188 bp)
chr MWPT01000439.1 (1596044 bp)
chr MWPT01000440.1 (1470869 bp)
chr KV918349.1 (1124868 bp)
chr MWPT01000446.1 (1358169 bp)
chr MWPT01000447.1 (1303672 bp)
chr MWPT01000448.1 (1292038 bp)
chr KV918350.1 (2216547 bp)
chr KV918351.1 (2144614 bp)
chr KV918352.1 (2200068 bp)
chr MWPT01000458.1 (1154801 bp)
chr KV918353.1 (1249097 bp)
chr MWPT01000461.1 (1054511 bp)
chr MWPT01000462.1 (1029825 bp)
chr KV918354.1 (1474778 bp)
chr KV918355.1 (1882473 bp)
chr KV918356.1 (1195088 bp)
chr KV918357.1 (945790 bp)
chr MWPT01000471.1 (901603 bp)
chr MWPT01000472.1 (883242 bp)
chr MWPT01000473.1 (863120 bp)
chr KV918358.1 (906525 bp)
chr KV918359.1 (1452728 bp)
chr MWPT01000480.1 (748682 bp)
chr KV918360.1 (659974 bp)
chr KV918361.1 (466019 bp)
chr MWPT01000013.1 (1300831 bp)
chr MWPT01000131.1 (1971208 bp)
chr KV918362.1 (2791541 bp)
chr KV918363.1 (1907303 bp)
chr MWPT01000397.1 (1723226 bp)
chr MWPT01000410.1 (500894 bp)
chr KV918364.1 (6892396 bp)
chr KV918365.1 (7468933 bp)
chr MWPT01000490.1 (3601090 bp)
chr MWPT01000491.1 (2581635 bp)
chr MWPT01000492.1 (2281164 bp)
chr KV918366.1 (3576272 bp)
chr KV918367.1 (3792723 bp)
chr KV918368.1 (2247201 bp)
chr KV918369.1 (2662616 bp)
chr KV918370.1 (2530331 bp)
chr MWPT01000510.1 (1983864 bp)
chr KV918371.1 (1956835 bp)
chr KV918372.1 (3086374 bp)
chr KV918373.1 (3420601 bp)
chr KV918374.1 (1975111 bp)
chr MWPT01000522.1 (1408919 bp)
chr KV918375.1 (2529433 bp)
chr KV918376.1 (1290748 bp)
chr KV918377.1 (2437656 bp)
chr MWPT01000531.1 (1154204 bp)
chr KV918378.1 (1139503 bp)
chr MWPT01000536.1 (868008 bp)
chr MWPT01000537.1 (771245 bp)
chr KV918379.1 (1322005 bp)
chr KV918380.1 (1966111 bp)
chr MWPT01000546.1 (662674 bp)
chr KV918381.1 (1109647 bp)
chr KV918382.1 (871299 bp)
chr MWPT01000551.1 (451986 bp)
chr MWPT01000552.1 (323820 bp)
chr MWPT01000553.1 (248130 bp)
chr MWPT01000240.1 (21598 bp)
chr KV918383.1 (3521928 bp)
chr KV918384.1 (978841 bp)
chr KV918385.1 (9025367 bp)
chr MWPT01000562.1 (6788731 bp)
chr MWPT01000563.1 (4429963 bp)
chr KV918386.1 (3718566 bp)
chr MWPT01000566.1 (2001120 bp)
chr MWPT01000567.1 (1613306 bp)
chr MWPT01000568.1 (1271813 bp)
chr MWPT01000569.1 (1139655 bp)
chr KV918387.1 (1748706 bp)
chr KV918388.1 (1215097 bp)
chr KV918389.1 (1703051 bp)
chr MWPT01000577.1 (293636 bp)
chr MWPT01000578.1 (295967 bp)
chr MWPT01000072.1 (5034843 bp)
chr KV918390.1 (3800859 bp)
chr KV918391.1 (6003931 bp)
chr KV918392.1 (2421970 bp)
chr KV918393.1 (3397556 bp)
chr KV918394.1 (2301794 bp)
chr MWPT01000091.1 (2010889 bp)
chr MWPT01000092.1 (1561902 bp)
chr KV918395.1 (3939623 bp)
chr KV918396.1 (2232430 bp)
chr MWPT01000100.1 (1208491 bp)
chr KV918397.1 (1229882 bp)
chr MWPT01000103.1 (1025708 bp)
chr MWPT01000104.1 (844690 bp)
chr MWPT01000105.1 (846079 bp)
chr KV918398.1 (863292 bp)
chr MWPT01000108.1 (789389 bp)
chr KV918399.1 (1241954 bp)
chr KV918400.1 (916510 bp)
chr KV918401.1 (671914 bp)
chr KV918402.1 (729568 bp)
chr KV918403.1 (549473 bp)
chr KV918404.1 (160532 bp)
chr MWPT01000579.1 (2935297 bp)
chr KV918405.1 (5824940 bp)
chr KV918406.1 (2707926 bp)
chr KV918407.1 (3442549 bp)
chr MWPT01000590.1 (1838142 bp)
chr MWPT01000591.1 (1545713 bp)
chr MWPT01000592.1 (1371629 bp)
chr KV918408.1 (1462725 bp)
chr MWPT01000595.1 (1312981 bp)
chr MWPT01000596.1 (1285219 bp)
chr MWPT01000597.1 (1227422 bp)
chr KV918409.1 (1203654 bp)
chr MWPT01000600.1 (1196254 bp)
chr MWPT01000601.1 (1154798 bp)
chr KV918410.1 (1085728 bp)
chr MWPT01000604.1 (1073738 bp)
chr MWPT01000605.1 (899834 bp)
chr MWPT01000606.1 (900897 bp)
chr MWPT01000607.1 (849686 bp)
chr KV918411.1 (1258750 bp)
chr KV918412.1 (1120238 bp)
chr MWPT01000613.1 (760141 bp)
chr MWPT01000614.1 (778878 bp)
chr KV918413.1 (1402054 bp)
chr KV918414.1 (1077603 bp)
chr KV918415.1 (749799 bp)
chr MWPT01000625.1 (722770 bp)
chr MWPT01000626.1 (678901 bp)
chr MWPT01000627.1 (669847 bp)
chr MWPT01000628.1 (667292 bp)
chr MWPT01000629.1 (642728 bp)
chr MWPT01000630.1 (633911 bp)
chr MWPT01000631.1 (660918 bp)
chr MWPT01000632.1 (580050 bp)
chr MWPT01000633.1 (613152 bp)
chr KV918416.1 (844482 bp)
chr MWPT01000636.1 (568697 bp)
chr MWPT01000637.1 (538392 bp)
chr MWPT01000638.1 (547116 bp)
chr MWPT01000639.1 (558824 bp)
chr MWPT01000640.1 (520851 bp)
chr MWPT01000641.1 (477734 bp)
chr MWPT01000642.1 (459272 bp)
chr MWPT01000643.1 (443597 bp)
chr MWPT01000644.1 (419018 bp)
chr MWPT01000645.1 (366979 bp)
chr MWPT01000646.1 (347696 bp)
chr KV918417.1 (563568 bp)
chr MWPT01000649.1 (350730 bp)
chr MWPT01000650.1 (326770 bp)
chr MWPT01000651.1 (323883 bp)
chr MWPT01000652.1 (306033 bp)
chr MWPT01000653.1 (253517 bp)
chr MWPT01000654.1 (211301 bp)
chr KV918418.1 (476935 bp)
chr KV918419.1 (259728 bp)
chr MWPT01000660.1 (194985 bp)
chr MWPT01000661.1 (172347 bp)
chr MWPT01000662.1 (120632 bp)
chr KV918420.1 (154501 bp)
chr KV918421.1 (125890 bp)
chr MWPT01000667.1 (73767 bp)
chr KV918422.1 (125540 bp)
chr MWPT01000670.1 (67795 bp)
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Single-end alignments will be performed
=======================================
Finished subdividing 2112_lane1_TTAGGC_L001_R1_trimmed.fq for PID: 0 and offset 8
Using the subset file >2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8< as new in-file (instead of >2112_lane1_TTAGGC_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8 to 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_C_to_T.fastq
Finished subdividing 2112_lane1_TTAGGC_L001_R1_trimmed.fq for PID: 0 and offset 4
Using the subset file >2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4< as new in-file (instead of >2112_lane1_TTAGGC_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4 to 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_C_to_T.fastq
Finished subdividing 2112_lane1_TTAGGC_L001_R1_trimmed.fq for PID: 0 and offset 1
Finished subdividing 2112_lane1_TTAGGC_L001_R1_trimmed.fq for PID: 0 and offset 3
Using the subset file >2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1< as new in-file (instead of >2112_lane1_TTAGGC_L001_R1_trimmed.fq<)
Using the subset file >2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3< as new in-file (instead of >2112_lane1_TTAGGC_L001_R1_trimmed.fq<)
Input file is in FastQ format
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3 to 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_C_to_T.fastq
Writing a C -> T converted version of the input file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1 to 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_C_to_T.fastq
Finished subdividing 2112_lane1_TTAGGC_L001_R1_trimmed.fq for PID: 0 and offset 6
Using the subset file >2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6< as new in-file (instead of >2112_lane1_TTAGGC_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6 to 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_C_to_T.fastq
Finished subdividing 2112_lane1_TTAGGC_L001_R1_trimmed.fq for PID: 0 and offset 5
Using the subset file >2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5< as new in-file (instead of >2112_lane1_TTAGGC_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5 to 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_C_to_T.fastq
Finished subdividing 2112_lane1_TTAGGC_L001_R1_trimmed.fq for PID: 0 and offset 7
Using the subset file >2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7< as new in-file (instead of >2112_lane1_TTAGGC_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7 to 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_C_to_T.fastq
Finished subdividing 2112_lane1_TTAGGC_L001_R1_trimmed.fq for PID: 0 and offset 2
Using the subset file >2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2< as new in-file (instead of >2112_lane1_TTAGGC_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2 to 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_C_to_T.fastq
Finished subdividing 2112_lane1_TTAGGC_L001_R1_trimmed.fq for PID: 14540 and offset 9
Using the subset file >2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9< as new in-file (instead of >2112_lane1_TTAGGC_L001_R1_trimmed.fq<)
Input file is in FastQ format
Writing a C -> T converted version of the input file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9 to 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_C_to_T.fastq
Created C -> T converted version of the FastQ file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6 (2502037 sequences in total)
Input file is 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5 (2502037 sequences in total)
Input file is 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4 (2502037 sequences in total)
Input file is 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2 (2502037 sequences in total)
Input file is 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1420:2130_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTATTTTTATTATAATAATAAATATTTTTTATATTAAAAAATATAAAAAAAAAATAAATTTTTATATAAAATATATATATATAAAATATTTAAAATATT @CCFFFFFHAHHHJJJIIIJGIIIJJJJJJJJJJIJJGEIJJJJIIJJJJJIHFDDEDDDDBDC>:>>CDDDC982<80258<@B<A>ACCDDCD?ACAD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1427:2107_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTTGAAAATTAAAAATAAAATATTGGTATATATTAAAAAATTTTAAATATTAAATAAATTTT =@=AD?1<CDFFF<FGEBH4FH<A3C?@F86B9D9DGFFIIFIB7=FFI>EC5CFE>AB7@;?? YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3 (2502037 sequences in total)
Input file is 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1 (2502037 sequences in total)
Input file is 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1123:2211_1:N:0:TTAGGC 4 * 0 0 * * 0 0 ATTATTATAAATTAATTATTTTTATAATAATTTTTTTAATATTTTTTATTTAAAATTTTTAAAATTAAAAAAATTAATAAATTTTATTTTTATAATTTAT ?@BDFFFFFHGHHJAHIFHJIJIHHHIIJIJJJJJJGGIIEIIIJJJIJIJCGGBDDHIJGGHIEHIDFHIE>@CCACCCCCCDDDDDDDDDDCCCDDCD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1378:2089_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TATGTTGTATATTATATTTTTGTGATAATATTATTGTAATTATAAAAAAAAATTATAATATATTTATATAAATTTTTGATTATAATTGTTGAAATAAAAA CCCFFFFDHHHHHJJJJJJJJJJJIIJJJGIGJIIJHIGIJJJIJJJJJHFDCCCDDDDDDDEDEFDDDDDBBBC<ABDBDDDDDDDDBBDBBDDDDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Created C -> T converted version of the FastQ file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7 (2502037 sequences in total)
Input file is 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Created C -> T converted version of the FastQ file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8 (2502036 sequences in total)
Input file is 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1192:2181_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TATATTAAAATTATTTTAATAAAAAATATTTGTTTTATAATAATTATTTTTTTAAATTTATAATATTTATATTAATTATAAAATGTTTAATAATAAAATT ??@+=BDDF?FAAE<E,CHHFC@GEEGFIE>A:D*?D@FE@?909DBB*??<BC)=F@@FICCEEE;C=EED;BB6;ABCCABBB(999:@A:@A@55:@ YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1420:2130_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTATTTTTATTATAATAATAAATATTTTTTATATTAAAAAATATAAAAAAAAAATAAATTTTTATATAAAATATATATATATAAAATATTTAAAATATT @CCFFFFFHAHHHJJJIIIJGIIIJJJJJJJJJJIJJGEIJJJJIIJJJJJIHFDDEDDDDBDC>:>>CDDDC982<80258<@B<A>ACCDDCD?ACAD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1427:2107_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTTGAAAATTAAAAATAAAATATTGGTATATATTAAAAAATTTTAAATATTAAATAAATTTT =@=AD?1<CDFFF<FGEBH4FH<A3C?@F86B9D9DGFFIIFIB7=FFI>EC5CFE>AB7@;?? YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam <<<
Created C -> T converted version of the FastQ file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9 (2502036 sequences in total)
Input file is 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_C_to_T.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/srlab/Documents/C-virginica-BSSeq/genome/ with the specified options: -q -N 1 --score-min L,0,-0.2 --ignore-quals
Now starting the Bowtie 2 aligner for CTreadCTgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --norc)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/CT_conversion/BS_CT
Reading in the sequence file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1158:2233_1:N:0:TTAGGC 4 * 0 0 * * 0 0 AATGGGTAATATTTTAAAAAATAAAATGTTAATTTTAATTTAAAAAAATTTAATTTATTATTTAATATTAATTTTAATTTAAAAAAATTTAATTTTATTAT CCCFFFFF?>FHFJIIHGIIJGIHEDH??FHIJJJHGIIIHGB<FBH8BEH?DFDE@CCDCDCCDDCCCDCDDCDCDDDC@>CCDDDBBDDDDDDDDDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1378:2089_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TATGTTGTATATTATATTTTTGTGATAATATTATTGTAATTATAAAAAAAAATTATAATATATTTATATAAATTTTTGATTATAATTGTTGAAATAAAAA CCCFFFFDHHHHHJJJJJJJJJJJIIJJJGIGJIIJHIGIJJJIJJJJJHFDCCCDDDDDDDEDEFDDDDDBBBC<ABDBDDDDDDDDBBDBBDDDDDDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1285:2160_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTTGAAAATTAAAAAATGAATTATTTTGATTAATTGTTGTTTTATAAAAAAAAAATGAAAATTTATGATTTTATTAAATATTTATATTAATTATTATT CCCFFFFFHHHHHJJJJJJJJJJJJIIHIJJJJJIJJIGJHIJJHHFEEEDCBDDDDDB<?@BCBB?B@5>BDC32>CCDDABCDDDDEEEEDDCCDDED YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1365:2176_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTGATTTTTTTAATTTAAAATTATAAATTAAAATTTTAAATAAATTTGAATTTAATGAAATTAATAATGAAATTTTTAAAAAATTTATTATTTTAATTG @@@FFFFAHHGHFIJJIEIFIIIJIGHIIIJIHIGIJJJIJIGGIJJJJAGHJJJGHHD@FIIIIGHICAEEFFF;@DEDEABDDACDDDEEDDECCDBD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Reading in the sequence file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1123:2211_1:N:0:TTAGGC 4 * 0 0 * * 0 0 ATTATTATAAATTAATTATTTTTATAATAATTTTTTTAATATTTTTTATTTAAAATTTTTAAAATTAAAAAAATTAATAAATTTTATTTTTATAATTTAT ?@BDFFFFFHGHHJAHIFHJIJIHHHIIJIJJJJJJGGIIEIIIJJJIJIJCGGBDDHIJGGHIEHIDFHIE>@CCACCCCCCDDDDDDDDDDCCCDDCD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1192:2181_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TATATTAAAATTATTTTAATAAAAAATATTTGTTTTATAATAATTATTTTTTTAAATTTATAATATTTATATTAATTATAAAATGTTTAATAATAAAATT ??@+=BDDF?FAAE<E,CHHFC@GEEGFIE>A:D*?D@FE@?909DBB*??<BC)=F@@FICCEEE;C=EED;BB6;ABCCABBB(999:@A:@A@55:@ YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1365:2176_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTGATTTTTTTAATTTAAAATTATAAATTAAAATTTTAAATAAATTTGAATTTAATGAAATTAATAATGAAATTTTTAAAAAATTTATTATTTTAATTG @@@FFFFAHHGHFIJJIEIFIIIJIGHIIIJIHIGIJJJIJIGGIJJJJAGHJJJGHHD@FIIIIGHICAEEFFF;@DEDEABDDACDDDEEDDECCDBD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam <<<
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1394:2182_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTATTTTTTATATAATTAATTTAATTTTAATTTTAATATTTAAATTTTAATTAGTAATTATAATATTAATATTATTATATAAATAAATATTATTAATT @?@4BDEFHHHHHJJJJIJJJIIJJIJJJJJJIIJJJJJIIJJJJIJJJJJJJJJJJJGGJIJJJJHHHHHGFFFBDEDEEEEEEDDBDDDDDDDDDDDD YT:Z:UU
Now starting the Bowtie 2 aligner for CTreadGAgenome (reading in sequences from 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_C_to_T.fastq with options -q -N 1 --score-min L,0,-0.2 --ignore-quals --nofw)
Using Bowtie 2 index: /home/srlab/Documents/C-virginica-BSSeq/genome/Bisulfite_Genome/GA_conversion/BS_GA
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1285:2160_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTTGAAAATTAAAAAATGAATTATTTTGATTAATTGTTGTTTTATAAAAAAAAAATGAAAATTTATGATTTTATTAAATATTTATATTAATTATTATT CCCFFFFFHHHHHJJJJJJJJJJJJIIHIJJJJJIJJIGJHIJJHHFEEEDCBDDDDDB<?@BCBB?B@5>BDC32>CCDDABCDDDDEEEEDDCCDDED YT:Z:UU
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1158:2233_1:N:0:TTAGGC 4 * 0 0 * * 0 0 AATGGGTAATATTTTAAAAAATAAAATGTTAATTTTAATTTAAAAAAATTTAATTTATTATTTAATATTAATTTTAATTTAAAAAAATTTAATTTTATTAT CCCFFFFF?>FHFJIIHGIIJGIHEDH??FHIJJJHGIIIHGB<FBH8BEH?DFDE@CCDCDCCDDCCCDCDDCDCDDDC@>CCDDDBBDDDDDDDDDDDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam <<<
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8
Reading in the sequence file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7
Reading in the sequence file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3
Found first alignment: HWI-ST0747:461:C64YUACXX:1:1101:1394:2182_1:N:0:TTAGGC 4 * 0 0 * * 0 0 TTTTATTTTTTATATAATTAATTTAATTTTAATTTTAATATTTAAATTTTAATTAGTAATTATAATATTAATATTATTATATAAATAAATATTATTAATT @?@4BDEFHHHHHJJJJIJJJIIJJIJJJJJJIIJJJJJIIJJJJIJJJJJJJJJJJJGGJIJJJJHHHHHGFFFBDEDEEEEEEDDBDDDDDDDDDDDD YT:Z:UU
>>> Writing bisulfite mapping results to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam <<<
Reading in the sequence file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 1000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
Processed 2000000 sequences so far
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2388450 (95.46%) aligned 0 times
65882 (2.63%) aligned exactly 1 time
47705 (1.91%) aligned >1 times
4.54% overall alignment rate
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2390347 (95.54%) aligned 0 times
65375 (2.61%) aligned exactly 1 time
46315 (1.85%) aligned >1 times
4.46% overall alignment rateProcessed 2502037 sequences in total
Successfully deleted the temporary file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2502037
Number of alignments with a unique best hit from the different alignments: 112155
Mapping efficiency: 4.5%Sequences with no alignments under any condition: 2329895
Sequences did not map uniquely: 59987
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 57269 ((converted) top strand)
CT/GA: 54886 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2280034
Total methylated C's in CpG context: 334304
Total methylated C's in CHG context: 298937
Total methylated C's in CHH context: 960855
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 61099
Total unmethylated C's in CHG context: 216518
Total unmethylated C's in CHH context: 408321
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.5%
C methylated in CHG context: 58.0%
C methylated in CHH context: 70.2%
C methylated in Unknown context (CN or CHN): 100.0%
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2388039 (95.44%) aligned 0 times
66318 (2.65%) aligned exactly 1 time
47680 (1.91%) aligned >1 times
4.56% overall alignment rate
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2389263 (95.49%) aligned 0 times
66016 (2.64%) aligned exactly 1 time
46758 (1.87%) aligned >1 times
4.51% overall alignment rateProcessed 2502037 sequences in total
Successfully deleted the temporary file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2502037
Number of alignments with a unique best hit from the different alignments: 113542
Mapping efficiency: 4.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2304569
Total methylated C's in CpG context: 337831
Total methylated C's in CHG context: 302690
Total methylated C's in CHH context: 967732
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 61246
Total unmethylated C's in CHG context: 219932
Total unmethylated C's in CHH context: 415138
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.7%
C methylated in CHG context: 57.9%
C methylated in CHH context: 70.0%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2328502
Sequences did not map uniquely: 59993
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 57630 ((converted) top strand)
CT/GA: 55912 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2388044 (95.44%) aligned 0 times
66613 (2.66%) aligned exactly 1 time
47380 (1.89%) aligned >1 times
4.56% overall alignment rate
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2389969 (95.52%) aligned 0 times
65677 (2.62%) aligned exactly 1 time
46391 (1.85%) aligned >1 times
4.48% overall alignment rateProcessed 2502037 sequences in total
Successfully deleted the temporary file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2502037
Number of alignments with a unique best hit from the different alignments: 112894
Mapping efficiency: 4.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2291305
Total methylated C's in CpG context: 336634
Total methylated C's in CHG context: 302441
Total methylated C's in CHH context: 961915
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 61307
Total unmethylated C's in CHG context: 217247
Total unmethylated C's in CHH context: 411761
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.6%
C methylated in CHG context: 58.2%
C methylated in CHH context: 70.0%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2329262
Sequences did not map uniquely: 59881
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 57675 ((converted) top strand)
CT/GA: 55219 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02502036 reads; of these:
2502036 (100.00%) were unpaired; of these:
2390416 (95.54%) aligned 0 times
65538 (2.62%) aligned exactly 1 time
46082 (1.84%) aligned >1 times
4.46% overall alignment rate
2502036 reads; of these:
2502036 (100.00%) were unpaired; of these:
2388145 (95.45%) aligned 0 times
66543 (2.66%) aligned exactly 1 time
47348 (1.89%) aligned >1 times
4.55% overall alignment rateProcessed 2502036 sequences in total
Successfully deleted the temporary file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2502036
Number of alignments with a unique best hit from the different alignments: 112734
Mapping efficiency: 4.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2291162
Total methylated C's in CpG context: 336414
Total methylated C's in CHG context: 301340
Total methylated C's in CHH context: 961738
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 61948
Total unmethylated C's in CHG context: 217637
Total unmethylated C's in CHH context: 412085
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.4%
C methylated in CHG context: 58.1%
C methylated in CHH context: 70.0%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2329482
Sequences did not map uniquely: 59820
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 57693 ((converted) top strand)
CT/GA: 55041 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02502036 reads; of these:
2502036 (100.00%) were unpaired; of these:
2388336 (95.46%) aligned 0 times
66262 (2.65%) aligned exactly 1 time
47438 (1.90%) aligned >1 times
4.54% overall alignment rate
2502036 reads; of these:
2502036 (100.00%) were unpaired; of these:
2390306 (95.53%) aligned 0 times
65403 (2.61%) aligned exactly 1 time
46327 (1.85%) aligned >1 times
4.47% overall alignment rateProcessed 2502036 sequences in total
Successfully deleted the temporary file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2502036
Number of alignments with a unique best hit from the different alignments: 112715
Mapping efficiency: 4.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2292754
Total methylated C's in CpG context: 336433
Total methylated C's in CHG context: 301629
Total methylated C's in CHH context: 959409
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 62840
Total unmethylated C's in CHG context: 219008
Total unmethylated C's in CHH context: 413435
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.3%
C methylated in CHG context: 57.9%
C methylated in CHH context: 69.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
Now waiting for all child processes to completeSequences with no alignments under any condition: 2329461
Sequences did not map uniquely: 59860
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 57530 ((converted) top strand)
CT/GA: 55185 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2387650 (95.43%) aligned 0 times
67014 (2.68%) aligned exactly 1 time
47373 (1.89%) aligned >1 times
4.57% overall alignment rate
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2390163 (95.53%) aligned 0 times
65493 (2.62%) aligned exactly 1 time
46381 (1.85%) aligned >1 times
4.47% overall alignment rateProcessed 2502037 sequences in total
Successfully deleted the temporary file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2502037
Number of alignments with a unique best hit from the different alignments: 113533
Mapping efficiency: 4.5%Sequences with no alignments under any condition: 2328758
Sequences did not map uniquely: 59746
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 58351 ((converted) top strand)
CT/GA: 55182 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2305084
Total methylated C's in CpG context: 339015
Total methylated C's in CHG context: 302604
Total methylated C's in CHH context: 964947
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 62035
Total unmethylated C's in CHG context: 220704
Total unmethylated C's in CHH context: 415779
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.5%
C methylated in CHG context: 57.8%
C methylated in CHH context: 69.9%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2388360 (95.46%) aligned 0 times
65948 (2.64%) aligned exactly 1 time
47729 (1.91%) aligned >1 times
4.54% overall alignment rate
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2390196 (95.53%) aligned 0 times
65340 (2.61%) aligned exactly 1 time
46501 (1.86%) aligned >1 times
4.47% overall alignment rateProcessed 2502037 sequences in total
Successfully deleted the temporary file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2502037
Number of alignments with a unique best hit from the different alignments: 112816
Mapping efficiency: 4.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2294851
Total methylated C's in CpG context: 337899
Total methylated C's in CHG context: 302036
Total methylated C's in CHH context: 963166
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 61812
Total unmethylated C's in CHG context: 217614
Total unmethylated C's in CHH context: 412324
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.5%
C methylated in CHG context: 58.1%
C methylated in CHH context: 70.0%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2329301
Sequences did not map uniquely: 59920
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 57721 ((converted) top strand)
CT/GA: 55095 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2387879 (95.44%) aligned 0 times
66507 (2.66%) aligned exactly 1 time
47651 (1.90%) aligned >1 times
4.56% overall alignment rate
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2390275 (95.53%) aligned 0 times
65418 (2.61%) aligned exactly 1 time
46344 (1.85%) aligned >1 times
4.47% overall alignment rateProcessed 2502037 sequences in total
Successfully deleted the temporary file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2502037
Number of alignments with a unique best hit from the different alignments: 112644
Mapping efficiency: 4.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2289004
Total methylated C's in CpG context: 337654
Total methylated C's in CHG context: 300264
Total methylated C's in CHH context: 955976
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 61413
Total unmethylated C's in CHG context: 218996
Total unmethylated C's in CHH context: 414701
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.6%
C methylated in CHG context: 57.8%
C methylated in CHH context: 69.7%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2329434
Sequences did not map uniquely: 59959
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 57825 ((converted) top strand)
CT/GA: 54819 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 02502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2388214 (95.45%) aligned 0 times
66187 (2.65%) aligned exactly 1 time
47636 (1.90%) aligned >1 times
4.55% overall alignment rate
2502037 reads; of these:
2502037 (100.00%) were unpaired; of these:
2389837 (95.52%) aligned 0 times
65737 (2.63%) aligned exactly 1 time
46463 (1.86%) aligned >1 times
4.48% overall alignment rateProcessed 2502037 sequences in total
Successfully deleted the temporary file 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_C_to_T.fastq
Final Alignment report
======================
Sequences analysed in total: 2502037
Number of alignments with a unique best hit from the different alignments: 113008
Mapping efficiency: 4.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 2294376
Total methylated C's in CpG context: 336299
Total methylated C's in CHG context: 302294
Total methylated C's in CHH context: 962723
Total methylated C's in Unknown context: 0
Total unmethylated C's in CpG context: 62573
Total unmethylated C's in CHG context: 219262
Total unmethylated C's in CHH context: 411225
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.3%
C methylated in CHG context: 58.0%
C methylated in CHH context: 70.1%
Can't determine percentage of methylated Cs in Unknown context (CN or CHN) if value was 0Sequences with no alignments under any condition: 2329238
Sequences did not map uniquely: 59791
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 57605 ((converted) top strand)
CT/GA: 55403 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1
Right, cleaning up now...
Deleting temporary sequence files...2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9 Now merging BAM files 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam into >>> 2112_lane1_TTAGGC_L001_R1_trimmed_bismark_bt2.bam <<<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam <</home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_bismark_bt2.bam Deleting temporary BAM files.../home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_bismark_bt2.bam /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_bismark_bt2.bam Writing report to /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed_bismark_bt2_SE_report.txt
Now merging temporary reports 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt into >>> /home/srlab/Documents/C-virginica-BSSeq/2112_lane1_TTAGGC/2112_lane1_TTAGGC_L001_R1_trimmed_bismark_bt2_SE_report.txt <<<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt <<
Merging from file >> 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt <<
Printing a final merged alignment report for all individual sub-reports
Final Alignment report
======================
Sequences analysed in total: 22518331
Number of alignments with a unique best hit from the different alignments: 1016041
Mapping efficiency: 4.5%
Final Cytosine Methylation Report
=================================
Total number of C's analysed: 20643139
Total methylated C's in CpG context: 3032483
Total methylated C's in CHG context: 2714235
Total methylated C's in CHH context: 8658461
Total methylated C's in Unknown context: 1
Total unmethylated C's in CpG context: 556273
Total unmethylated C's in CHG context: 1966918
Total unmethylated C's in CHH context: 3714769
Total unmethylated C's in Unknown context: 0
C methylated in CpG context: 84.5%
C methylated in CHG context: 58.0%
C methylated in CHH context: 70.0%
C methylated in Unknown context (CN or CHN): 100.0%
Deleting temporary report files...Sequences with no alignments under any condition: 20963333
Sequences did not map uniquely: 538957
Sequences which were discarded because genomic sequence could not be extracted: 0
Number of sequences with unique best (first) alignment came from the bowtie output:
CT/CT: 519299 ((converted) top strand)
CT/GA: 496742 ((converted) bottom strand)
GA/CT: 0 (complementary to (converted) top strand)
GA/GA: 0 (complementary to (converted) bottom strand)
Number of alignments to (merely theoretical) complementary strands being rejected in total: 0
2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.1_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.2_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.3_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.4_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.5_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.6_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.7_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.8_bismark_bt2_SE_report.txt 2112_lane1_TTAGGC_L001_R1_trimmed.fq.temp.9_bismark_bt2_SE_report.txt
====================
Bismark run complete
====================