08.13.12
Summary: Finishing results section of Lake trout RNA-Seq manuscriptUsed a new test for differential expression - DESeq in R - and compared to previous methods for testing for differential expression
Results:
| Baggerly's FDR |
DE-Seq Unique Counts |
DE-Seq Total Counts |
Baggerly AND 2-fold Difference |
|
| Significant DE |
340 |
117 |
121 |
66 |
| Not Significant |
9024 |
9247 |
9243 |
8639 |
==
==
07.24.12
Summary: Preparing thesis chapter two on sockeye senescence for publication.Worked through the incorporation of gene expression assay design into the manuscript.
Progress on the senescence manuscript can be viewed here.
01.09.12
Summary: Reprise of Lake Trout RNA-Seq project for FISH546
Below is all of the Lake Trout NGS data that I have access to. I will be working with the Lean and Siscowet muscle 454 and SOLiD libraries for this project.
My work on this project from this summer can be reviewed in FISH546 Notebook. I had left off making a table of all differentially expressed genes between Lean and Siscowet SOLiD libraries which can be found here and was playing with looking at differences in gene enrichment and even SNP pseudo-enrichment between the two libraries.
08.22.11
Summary: Making progress on the sockeye senescence chapter.
Fold over minimum normalized expression for each fish and each gene. A few individuals were thrown out.
==
==
08.10.11
Summary: Review of all sockeye senescence gene expression data to date.
08.09.11
Summary: GnRH and Viprin PCR w/ 60C annealing temp08.08.11
Summary: GnRH, Viprin, and 18S (rep2) qPCR
08.06.11
Summary: Test for DNA carryover and OMP1 qPCR.
08.03.11
Summary: NMDA and 18S qPCR AND test of qPCR primers
qPCR
Results can be seen here and methods here.
Still lots of individual variation, although the trend is the same as before (higher avg expression in pre-senescent salmon)
Things that are different about this assay:
- different platforms: previously I had run this assay on the Roche LighCycler on 384 well plate with dehydrated cDNA
- different cDNA
- addition of new samples- have included the reaming fish that Bradley extracted RNA
- different normalizing (housekeeping) gene: before I used beta actin
Next Steps:
1) check ALL RNA samples for carryover (use primers that will amplify gDNA for sure?)
2) try another gene
Primer test
Ran endpoint PCR using all of my qPCR senescence primers and gDNA to see if any of these primers amplify gDNA and make sure that my gDNA samples are good.
For methods see evernote notebook.
Next Steps:
Test RNA for carryover using OMP1 primers
08.02.11
Ran qPCR for TERT using the newly synthesized cDNA. PCR conditions and results reported here. No duplicates or normalizing gene. I also ran the RT negative, 2 PCR negatives, an RNased sample, and a genomic DNA sample all of which had no amplification. All gene expression results and Ct values are being recorded in this spreedsheet.Relative gene expression for TERT. There is lots of individual variation. This may actually true or there could also be some user error.
Next Steps: Going set up a new qPCR using the NMDA primers for which we have successfully measured differential expression in the past and run a normalizing gene (18S)
08.01.11
Finnished DNasing 07.29.11 samples and quanted DNased RNA. Also synthesized cDNA using 1ug of RNA or the max volume allowable (17.75ul) per rxn if the concentration was to low. This is summarized in the following table. For reaction details see evernote notebook
07.29.11
Last weekday of July! Oh my. Began DNasing samples from 07.28.11 using the rigorous protocol and a 30 ul rxn to remove any carryover DNA. Samples with an average concentration > 200ng/ul were diluted to 200ng/ul. These dilutions are recorded in a google spredsheet.07.28.11
Reprise of salmon senescence project. See evernote notebook for details. Started off by re-quanting all the 2009 sockeye senescence RNA samples.07.27.11
Working on my table of differentially expressed genes for Lake Trout and outlining the disscussion in my Lake Trout RNA-seqworking manuscript.
07.26.11
Sequencing results came in form 07.19.11. Began analyzing them and searching for SNPs. A pretty summary of this project and all the results is in the works.
==
==
07.16.11
Prepped MeSNPs samples for sequencing. Primers for methylation genes were designed and tested on 05.18.10. All of the primers that performed well were used for HRMA for 13 Alaskan sockeye samples. Samples for the primers with good HRM curves (n=14) were chosen for sequencing.
07.12.11
Lately, I have been working on putting together a Lake Trout manuscript for Pub-a-thon. This includes multiple iterations of analyses, lots of table joining, figuring out ways to visualize data, and writing. Some Lake Trout muscle 454 came to the surface recently so we went back to the drawing board using this 454 data as a reference for RNA-Seq. I have also been working on a way to measure genetic differences between the two ecotypes in silico using this data.
To see progress on the data analysis and writing please visit my working manuscript.
Also, Bradley has been working on testing the new Tert primers I designed and they seem to be working! Check out his lab notebook.
05.25.11
Summary: More clam RAD data analysis and MeSNPs.
Methods:
NEW RAD PIPELINE
See RAD data analysis here and Me SNP primer test results here.
Notes:
In regard to the RAD data, I have got the batch processing down and have all of the sequences filtered. Now I trying find diagnostic SNPs between the two groups. This is proving more difficult then expected because the sequence files are so large.
For the MeSNPs, some of the primers look great and there are some cool genes in this "good" group. The next step is to run PCRs for several individuals using the good primers and send these products off for sequencing to check for SNPs.
05.24.11
Summary: More clam RAD data analysis
Methods:
See RAD data analysis here and
05.20.11
Summary: Lake Trout RNA-Seq Analysis.
Pies and dot plots galore. Will post the figures soon.
05.19.11
Summary: Began analyzing clam RAD dataSee here.
05.18.10
Summary: MeSNPs primer testingMethods:
Primer Prep
Reconsituted primers in 100ul of 1x TE for stock
Made 50ul primer mix (Forward & Reverse) working stock
- 25 ul 100uM F primer
- 25 ul 100uM R primer
Primer Test
Made up 1:50 duilted primer plate for test PCR and prepared PCR using pooled sockeye DNA
05.16.11 & 05.17.11
Summary: Lake Trout RNA-seqBuilding pies and dot plots for the different GoSlims using the RNA-seq data from my different references
05.13.11
Summary: C1q PCR gel and sequence analysisSee sequence analysis here.
In summary, there is not enough sequence similarity to be confident that we have the same C1q sequence that the primers were designed for. Remember that there were multiple bands for each primer pair (See gel picture from 04.18.11). With out the corresponding gDNA sequence for the bisulfite converted product to BLAST it is difficult to say what the product is.
C1q Gel (from 05.11.11)
Surprise, surprise, more trouble with contaminated negatives. Either way it looks like some of the colonies did take up the vector.
05.11.11
Summary: C1q PCR and MeSNPsC1q PCR
Ran C1q PCR for colonies from 4.21.11. Some of these were not successfully amplified on 4.22.11 because there was to much template in the reactions.
per 30ul rxn:
- 15.0ul 2x Apex
- 0.15ul Topo plasmid primer F
- 0.15ul Topo plasmid primer R
- 14.7ul H20
ran thermocycler program CLNY under SBR
- 94C 8 min
- for 30 cycles
- 94C 45 sec
- 50C 1 min
- 72C 1.5 min
- 72C 10 min
- 4C 4eva
Samples from 04.21.11 (49, 56, and 58 have been sequenced. see analysis of these sequences from 05.13.11)
48 LT1
49 LT1
50 LT1
51 LT1
56 LT3
57 LT1
58 LT2
MeSNPs
Designed primers for NCBI sequences of interest and from annotated sockeye SOLiD consensus sequences using BatchPrimer3. I chose annotated based on the criterion outlined here.
05.10.11
Summary: Lake Trout RNA-Seq Annotation
Finished annotating Lake Trout RNA-Seq data from three references (LTmuscleDeNovo, LTallDeNovo, and SigenaeOmykiss) with SwissProt ID and description, GO terms, and GOslim terms. See Lake Trout RNA-Seq Annotation notes here. For the SigenaeOmykiss Ref there are three RNA-Seq tables, one for each GO category (process, component, and function).
Next Steps: Visualize this data in cool ways.
05.09.11
Summary: Methylation pathway SNPs and new tert primers
TERT Primers
Designed new TERT (telomerase reverse transcriptase). See how here.
Me SNPs
NCBI seqs annotated back to the correct gene SOLiD consensus sequences did not.
05.05.11
Summary: MeSNPs and Lake Trout gene expressionLake Trout RNA-seq
Ran stats on my RNA-seq data for all three comparisons. Annotating Lake Trout ref sequences. Pretty much running BLAST jobs on inquiry, learning galaxy, and more.
MeSNPs
I have been working on and off developing methyaltion pathway SNPs (see entries at the bottom of my notebook). My last attempt was a bust because when I annotated the resulting sanger sequences from that particular development pathway that did not annotate back to the correct genes of interest. There was an odd numbering scheme in CLC's blast table that we thought this was the result of. Once we figured out the numbering scheme we thought that we could avoid this error in the future by blasting all of the contigs of interest before designing primers.
05.04.11
Summary: Hard clam RAD library prep
RAD library prep continued
Dave brought the library through its test PCR and then we ran it on an e-gel. Both the library and PCR looked really good so Dave made up the final PCR using 24ul of template for the 100ul rxn.
After the final PCR product was cleaned-up I ran the entire product on another e-gel, cut out the library, and cleaned-up the gel extraction.
Purified Gel piece using Qiagen MinElute Gel Extraction Protocol
- incubated gel slice in 300 ul of QG at 50C
- added 100 ul of isopropanol
- eluted final sample in 14.5 ul of EB
Running the final RAD library from yesterday on the Bioanalyzer using a DNA7500 chip per manufacture's instructions. Concentration is measured as the area under the curve. The concentration is high enough (we need 100ng/ul) so we are going to send the library to the core lab for Illumina sequencing!
05.03.11
Summary: RAD library prep continued
RAD library prep continued
Dave prepped the samples I quanted yesterday for the RAD library and took the samples through P1 adaptor ligation. I picked up sample prep after this and began with pooling the samples.
- Pooled entirety of the barcoded samples and aliquoted 120 ul of pool into four 1.5 ml tubes
- note: I used the roberts lab tubes instead Seeb lab tubes. I checked the manufacturer's protocol for sonication and this should okay.
- Sheared pooled samples using the Bioruptor Sonicator
- 30 sec on/59 sec off for 3 cycles
- spun down samples
- repeated cycles and spin
- 30 sec on/59 sec off for 4 cycles
- spun down samples
- Purified sheared libraries using Qiagen MinElute Enzyme Reaction Protocol
- added 600 ul of PB to each library
- applied first library to spin column spun it down and repeated for remaining three libraries (this will concentrate our sample)
- eluted in 20 ul of EB
- Ran entire sample on Invitrogen E-gel Ex 1% Agarose per Manufacturer's instructions leaving an empty lane between ladder and sample
- Cut band between 350-650bp
- Purified Gel piece using Qiagen MinElute Gel Extraction Protocol
- incubated gel slice in 195 ul of QB
- added 65 ul of isopropanol
- eluted final sample in 20 ul of EB
- Set up Blunt Repair reaction by adding the following the cleaned-up RAD library
- 2.5 ul of Blunting Buffer
- 2.5 ul of dNTP mix
- 1.0 ul of Blunting enzyme
- Incubated rxn at RT for 1 hr
- Stored sample at -20C overnight
05.02.11
Summary: RAD library prep and Ran gene expression experiments for three RNAseq data sets
RAD library prep continued
Our final RAD library's concentration was to low so we went back to the drawing board with are original DNA samples. We dropped the number of samples to 8 and Dave EtOH precipitated each sample to clean them up. I quantified these newly prepared samples using the Invitrogen Quantit dsDNA broadrange kit which is a pico green assay that uses a standard curve. The first quant run revealed that sample MAX 4's concentration was to low. Dave prepared two new MAX samples and then I reran the picogreen assay for all of the samples.
- Prepared 1:200 Working Solution
- 1 ul Quant-iT BR Reagent per reaction (including standards)
- 199 ul of Quant-iT BR Buffer per reaction (including standards)
- Prepared pre-made standards in duplicate by adding 10 ul of each standard to 190 ul of 1:200 working solution
- Standard concentrations:100 ng/ul, 80 ng/ul, 60 ng/ul, 40 ng/ul, 20 ng/ul, 10 ng/ul, 5ng/ul, & 0 ng/ul
- Prepared samples by adding 1 ul of DNA to 199 ul of 1:200 working solution
- let samples incubate for 2 minutes and check for bubbles
- Read plate on Victor plate reader
Final calculated concentration. Please note the order of samples.
Standard Curve
Lake Trout Gene Expression
Still working to figure out what all of this means.
04.29.11
Summary: Hard clam RAD library prep continued and RNAseq for Lake Trout muscle
Hard Clam RAD Library Prep
Running the final RAD library from yesterday on the Bioanalyzer using a DNA7500 chip per manufacture's instructions.
This concentration is way to low to send of for sequencing.
04.28.11
Summary: Hard clam RAD library prep continuedHard Clam RAD Library Prep
Dave took RAD protocol through the test PCR. Then we ran the entire product on an E-gel with 5ul of the RAD library
There is amplification (whoo hoo) but it is really faint. In order to boost our DNA concentration Dave repeated the test PCR with 5 ul of template instead of the 1 ul used.
This band looks a lot brighter. We will go ahead and use this much template in our final PCR (see Dave's Notebook).
- Purified final PCR product using Qiagen MinElute PCR Purification Protocol
- added 500 ul of PB
- eluted in 20 ul of EB
- Ran the entire 20 ul on E-gel
- Purified Gel piece using Qiagen MinElute Gel Extraction Protocol
- incubated gel slice in 330 ul of QG
- added 110 ul of isopropanol
- eluted final sample in 14.5 ul of EB
- Stored sample at -20C
Next Steps: check concentration of sample on Bioanalyzer
04.27.11
Summary: Hard clam RAD library prep continued and Lean-SiscowetGeneExpression NGSHard Clam RAD Library Prep
Ran 5ul of test PCR and 5ul of RAD library from 04.16.11 on Invitrogen E-gel Ex 1% Agarose per Manufacturer's instructions. There is a faint smear for the RAD library and no smear for the PCR product (there should be a brighter and slightly larger product). This was after running samples on homemade 1% agarose. Nothing (even less) showed up on that gel. It was suggested that our DNA concentrations may be so low that the staining method (EtBr) was not sensitive enough so we tried an e-gel.
Troubleshooting...After some discussion we decided that all was not lost and that we just needed a higher DNA concentration for our pooled libraries. We will achieve this by going back to our barcoded individuals. make two seperate pools each containing all 12 individuals, and combine these on the same MinElute column after sonication.
- Pooled 20 ul of each (well mixed and barcoded) sample and split into two 120l aliquots
- Sheared pooled samples using the Bioruptor Sonicator
- 30 sec on/59 sec off for 3 cycles
- spun down samples
- repeated cycles and spin
- 30 sec on/59 sec off for 4 cycles
- spun down samples
- Purified sheared libraries using Qiagen MinElute Enzyme Reaction Protocol
- added 600 ul of PB to each library
- applied first library to spin column spun it down and then applied second column (this will concentrate our sample)
- eluted in 20 ul of EB
- Ran entire sample on Invitrogen E-gel Ex 1% Agarose per Manufacturer's instructions leaving an empty lane between ladder and sample
- Cut band between 350-650bp (outlined with white dashed line)
- Purified Gel piece using Qiagen MinElute Gel Extraction Protocol
- incubated gel slice in 195 ul of QG
- added 65 ul of isopropanol
- eluted final sample in 20 ul of EB
- Set up Blunt Repair reaction by adding the following the cleaned-up RAD library
- 2.5 ul of Blunting Buffer
- 2.5 ul of dNTP mix
- 1.0 ul of Blunting enzyme
- Incubated rxn at RT for 1 hr
Dave took over RAD library prep from here.
04.26.11
Projects:
- Gene expression in lean and siscowet lake trout
- Hard Clam project
- took over RAD library prep for clams where Dave left off on 04.26.11 (see Dave's notebook)
- began annotation of de novo assembled lake trout sequences
Hard Clam RAD Library Prep
- Purified A Overhang Reaction using Qiagen MinElute Enzyme Reaction Protocol
- Eluted in 44ul of EB
- Set up P2 Adaptor Ligation by adding the following the cleaned-up RAD libarary
- 5 ul of NEB Buffer 2
- 1 ul of P2 Adaptor
- .5 ul of rATP
- .5 ul of T4 DNA ligase
- Incubated rxn at RT for 1 hr
- Purified P2 Adaptor Ligation using Qiagen MinElute Enzyme Reaction Protocol
- Eluted in 50ul of EB
- 12.5 ul Phusion PCR Mix
- 10.5 ul H20
- 1 ul RAD primer mix
- 1 ul of template
- Ran cycling conditions
- 98C 30s
- 15 cycles of:
- 98C 10s
- 65C 30s
- 72C 30s
- 72C 5min
- 4C forever
De Novo consensus sequence annotation
In iNquiry set up blastx (translated nucleotide query/protein database) using the consensus sequences from my two de novo assemblies (1-muscle SOLiD seqs only; 2-all NGS sequences). Specified output of 1 short description and 1 alignment in a tabular format. For O.mykiss sequences used Sigenae contig browser extracted contig name, best hit accession, best hit %Qidentity, best hit database, best hit description, gene ontology, and go term code.
04.22.11
Projects:
- C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details)
- Gene expression in lean and siscowet lake trout
- Hard Clam project
- PCR of white colonies for C1q
- performed RNAseq for lean and siscowet using muscle de novo assembly as reference
- Requantified clam samples for RAD library
Colony PCR
per 30 ul reaction
15 ul 2x Apex
0.15 ul vector F primer
0.15 ul vector R primer
14.7 ul H20
Prepared 58 reactions. scraped off colonies with tip of pipet and let tip rest in each well.
| Number |
Well |
Sample |
Notes |
| 1 |
A01 |
1-1 |
Mac's |
| 2 |
A02 |
1-9 |
Mac's |
| 3 |
A03 |
1-10 |
Mac's |
| 4 |
A04 |
1-11 |
Mac's |
| 5 |
A05 |
1-12 |
Mac's |
| 6 |
A06 |
1-13 |
Mac's |
| 7 |
A07 |
3-12 |
Mac's |
| 8 |
A08 |
3-13 |
Mac's |
| 9 |
A09 |
3-14 |
Mac's |
| 10 |
A10 |
3-15 |
Mac's |
| 11 |
A11 |
3-16 |
Mac's |
| 12 |
A12 |
3-17 |
Mac's |
| 13 |
B01 |
3-18 |
Mac's |
| 14 |
B02 |
3-19 |
Mac's |
| 15 |
B03 |
3-20 |
Mac's |
| 16 |
B04 |
3-21 |
Mac's |
| 17 |
B05 |
3-22 |
Mac's |
| 18 |
B06 |
3-23 |
Mac's |
| 19 |
B07 |
3-24 |
Mac's |
| 20 |
B08 |
3-25 |
Mac's |
| 21 |
B09 |
3-26 |
Mac's |
| 22 |
B10 |
4-9 |
Mac's |
| 23 |
B11 |
4-10 |
Mac's |
| 24 |
B12 |
4-11 |
Mac's |
| 25 |
C01 |
4-12 |
Mac's |
| 26 |
C02 |
4-13 |
Mac's |
| 27 |
C03 |
5-9 |
Mac's |
| 28 |
C04 |
5-10 |
Mac's |
| 29 |
C05 |
5-11 |
Mac's |
| 30 |
C06 |
5-12 |
Mac's |
| 31 |
C07 |
5-13 |
Mac's |
| 32 |
C08 |
5-14 |
Mac's |
| 33 |
C09 |
5-15 |
Mac's |
| 34 |
C10 |
5-6 |
Mac's |
| 35 |
C11 |
5-17 |
Mac's |
| 36 |
C12 |
5-18 |
Mac's |
| 37 |
D01 |
5-19 |
Mac's |
| 38 |
D02 |
5-20 |
Mac's |
| 39 |
D03 |
5-21 |
Mac's |
| 40 |
D04 |
5-22 |
Mac's |
| 41 |
D05 |
5-23 |
Mac's |
| 42 |
D06 |
PGS 1 LB |
Steven's |
| 43 |
D07 |
PGS 2 |
Steven's |
| 44 |
D08 |
PGS 3 LB |
Steven's |
| 45 |
D09 |
PGS4 |
Steven's |
| 46 |
D10 |
LT2-1 |
C1q |
| 47 |
D11 |
LT1-5 |
C1q |
| 48 |
D12 |
LT1-4 |
C1q |
| 49 |
E01 |
LT1-3 |
C1q |
| 50 |
E02 |
LT1-2 |
C1q |
| 51 |
E03 |
LT1-1 |
C1q |
| 52 |
E04 |
LT4-1 LB |
C1q |
| 53 |
E05 |
LT3-1 LB |
C1q |
| 54 |
E06 |
LT2-3 LB |
C1q |
| 55 |
E07 |
LT2-2 LB |
C1q |
| 56 |
E08 |
LT3-2 |
C1q |
| 57 |
E09 |
LT1-6 |
C1q |
| 58 |
E10 |
LT2-4 |
C1q |
| 59 |
E11 |
neg |
|
| 60 |
E12 |
neg |
Sam ran products on a gel on 04.25.11. There was to much template in the PCR so many of the reactions were overblown. Three of my samples were prepared by Sam for sequencing: LT1-3, LT1-6, and .
Hard Clam RAD Libaray Prep
Requanted 4 Florida samples on Ghram's nanodrop for accurate measures of starting material for library prep.
Lean and Siscowet RNA-seq
Ran RNA-seq for lean and sisicowet muscle tissue using three different references: muscle de novo, all Lake Trout NGS seqs de novo, and Sigenae O.mykiss contigs.
04.21.11
Projects:
- C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details)
- Gene expression in lean and siscowet lake trout
Summary:
- replated white colonies C1q genes
- Lake Trout NGS trim results and began assembly of trimmed Lake Trout sequences
C1q Cloning
Notes: there were only a few white colonies
Replated following samples in quadrants on a a new large nutrient agar plate
Lean and Siscowet Gene Expression
Started de novo assemblies of Lake Trout sequences. Assembling two references, one using only the SOLiD muscle seqs and the other using all of the Lake Trout NGS seqs.
Muscle assembly
All LT NGS data assembly
04.20.11
Project:
- C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details)
- Hard clam project
- Gene expression in lean and siscowet lake trout
- Began cloning for C1q amplicons extracted from gel on 04.18.11
- Quantified DNA extractions from 04.19.11
- Trimmed SOLiD Muscle sequences for lean and siscowet trout and began de novo assembly of sequences to use as a reference for gene expression
DNA quantification
2ul of sample loaded onto the Nanodrop
Note: not all pellets had fully resuspended so I just confirmed the presence of DNA in all of the samples and will re-quantify at a later date for more accurate concentrations
Cloning (Invitrogen TOPO TA Cloning Kit)
1. Used MILLIPORE Ultrafree-DA kit to extract DNA from agarose gel slices frozen on 04.14.11 (see gel from 04.18.11)
2. Prepared TOPO cloning reaction
- 4 ul of PCR product (extracted from gel)
- 1 ul of salt solution
- 1 ul of TOPO vector
4. Prepared TOPO10 Competent cell transformation
- added 2l of TOPO cloning reaction to a vial of manufacturer prepared One Shot chemically competent E. coli
- incubated on ice for 10 minutes
- heat-shocked cells for 30 seconds at 42C then transfered immediately to ice
- added 250ul of RT S.O.C. medium to each vial and capped tightly
- incubated vials at 36C with horizinatl shaking (200 rpm) for 1 hour
- plated samples and incubated O/N at 30C
Gene Expression
1. Copied all of the available Lake Trout NGS to a new Lake Trout folder under my directory on CLC.
- Lake Trout NGS Data:
- 454 Mid1 Liver (note: no ecotype info)
- 454 Mid2 Liver (note: no ecotype info)
- Illumina Lean Liver
- Illumina Siscowet Liver
- SOLiD Lean Muscle
- SOLiD Siscowet Muscle
- Illumina Lean LampreyParasitized 1
- Illumina Lean LampreyParasitized 2
- Illumina Siscowet LampreyParasitized 1
- Illumina Siscowet LampreyParasitized 2
2. Began trimming all sequences using CLC's default criterion and a minimum read length of 20bp
Notes: no sequences were discarded for the 454 data suggesting that it had already been trimmed.
Next Steps: Replate colonies with plasmid insert. Assemble trimmed sequences. Requant clam samples.
04.19.11
Project:
- C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details)
- Hard calm project
- Annotation for C1q in Lake Trout
- Finishing DNA extraction of Florida and Canada hard clams for RAD sequencing
Methods:
DNAzol Genomic DNA Isolation
2. CENTRIFUGATION: Spun homogenate for 10 min at 10,000 g (and at 4C) and transfered supernatant to clean labeled tube (removes tissue fragments and other contaminants).
3. DNA PRECIPITATION: Added 500 ul of 100% EtOH to supernatant, inverted several times until well mixed, and then let sample incubate at RT for 3 min. Precipitated pellet via centrifugation at 5,000 g for 5 min (at 4C).
4. DNA WASH: Removed supernatant without distributing pellet. Washed pellet twice with 900 ul of 75% EtOH. Sedimented the pellet via centrifugation at 1,000 g for 2 min after each wash.
5. DNA SOLUBILIZATION: DNA was eluted in 100 ul of 8M NaOH w/HEPES (pH 8).
Notes: Pellets did not form easily and were loose. Saved tissue in freezer just in case. Will quant tomorrow.
Results:
Annotated gDNA sequence for C1q in trout. Primer sites are in green. Amplified regions excised from gel on 04.18.11 are labeled in blue. Sequence not present in siscowet Lake Trout is highlighted in yellow.
Next Steps:
Quant samples and prep for RAD.
04.18.11
Project: C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details) and hard calm project
Summary: Ran trout C1q hemi-nested PCR products on gel and excised bands for sequencing. Started DNA extraction of Florida and Canada hard clams for RAD sequencing.
Methods:
Agarose Gel Electrophoresis
Ran 20 ul of all 36 samples from 04.14.11 on 1% agarose gel for 50 minutes at 100V with Hyper1 ladder from Bioline. Excised bands of interest and stored them in 1.5 ul microcentrifuge tubes at -20C
DNAzol Genomic DNA Isolation
1. LYSIS/HOMGENIZATION: Lysed tissue in 500 ul of DNAzol and 2.7 ul of Protenase K in 1.5 ml microcentrifuge tubes. Incubated homogenate at RT overnight with inversion.
Results:
Excised 24 bands for sequencing are boxed.
Next Steps:
Prep trout C1q samples for sequencing and finish hard clam DNA extraction.
04.14.11
Project: C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details)
Summary: First round of C1q bisultfite treated DNA PCRs
Methods:
Hemi-nested PCR for bisulfite treated DNA (see Mac's notebook for an additional reference)
1st round PCR with primer sets A, B, and C from 04.06.11 and all four samples from 04.07.11
Per 25ul rxn:
- 1uL of template
- 12.5uL 2x Apex,
- 0.3uL each 10uM primer stock
- 10.9uL H20
- 95C 4min
- 5 cycles: 95C 30s, 52C 90s, 72C 120s
- 25 cycles: 95C 30s, 52C 90s, 72C 90s
- 72C 4min
- 4C hold
2nd round PCR using product from 1st round PCR and paring A, B, and C primers with their nested complement primer
Primer parings:
- A_F & Anest_R
- Anest_F & A_R
- B_F & Bnest_R
- Bnest_F & B_R
- C_F & Cnest_R
- Cnest_F & C_R
- 1uL of template (from 1st round PCR)
- 12.5uL 2x Apex,
- 0.3uL each 10uM primer stock
- 10.9uL H20
Next Steps: Run products on gel
04.13.11
Project: C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details)Summary: Finished bisulfite conversion. Quantified resulting product.
Methods:
Qiagen EpiTect Bisulfite Kit
- Performed cleanup of bisulfite converted DNA according to manufacturer's instructions
- Eluted product in 20 ul of EB
Results:
Yields of bisulfite converted DNA
Next Steps: Perform hemi-nested PCR.
04.06.11
Project: C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details)Summary: Began bisulfite conversion and designed hemi-nested primers for sequencing bisulfite converted products.
Methods:
Qiagen EpiTect Bisulfite Kit
- Dissolved 1 aliquot of Bisulfite Mix by adding 800ul of RNase-free water (provided) by vortexing and heating aliquot to 60C (remaining BiMix in -20C "Kit Reagents" box)
- Prepared bisulfite reactions with 1.75 ug of DNA template acording to table below:
- Performed bisulfite conversion on thermocycler using the following conditions:
Primer Design
- split 4,468 bp gene sequence into 3 (A, B, & C) ~1,400 bp sequences
- designed primers and nested primers for A, B, & C using MethPrimer
- Primer seqs can viewed here
Next Steps: Finish bisulfite conversion and test primers
04.05.11
Project: C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details)Summary: Quantified DNA from 04.04.11 on Nanodrop
Results:
04.04.11
Project: C1q in lean and siscowet lake trout (see C1q Evernote notebook for project details)Summary: Extracted DNA from 4 lake trout samples for bisulfite sequencing
Methods:
Samples
1- Lake Trout Lean_6 Liver
2- Lake Trout Lean_7 Liver
3- Lake Trout Siscowet_7 Liver
4- Lake Trout Siscowet_10 Liver
DNAzol Genomic DNA Isolation
1. LYSIS/HOMGENIZATION: Homogenized tissue with disposable pestle in 1.5 ml microcentrifuge tubes and 1 ml of DNAzol. Incubated homogenate at RT for 8 minutes.
2. CENTRIFUGATION: Spun homogenate for 10 min at 10,000 g and transfered supernatant to clean labeled tube (removes tissue fragments and other contaminants).
3. DNA PRECIPITATION: Added 500 ul of 100% EtOH to supernatant, inverted several times until well mixed, and then let sample incubate at RT for 3 min. Precipitated pellet via centrifugation at 5,000 g for 5 min.
4. DNA WASH: Removed supernatant without distributing pellet. Washed pellet twice with 900 ul of 75% EtOH. Sedimented the pellet via centrifugation at 1,000 g for 2 min after each wash.
5. DNA SOLUBILIZATION: DNA was eluted in 100 ul of TE (pH 8.5).
Next Steps:
Bisulfite conversion of samples
03.18.11
Project: Population specific methylation patterns in sockeye salmonSummary: Poly gel for 4 populations select PCR products from 03.17.11.
Methods:
Novex 6% TBE-Urea Gel 1.0mm 10 wells (adapted from manufacturer's protocol)
1. Prepare 1X running buffer
- Novex TBE Running Buffer (5X) 200 ml
- Deionized water 800 ml
- 50 bp DNA ladder (1ug/ul) 1 ul
- RNase free water 24 ul
- Diluted ladder (0.04ug/ul) 5 ul
- Novex TBE Urea Sample Buffer (2X) 5 ul
- Sample 2 ul
- Novex TBE Urea Sample Buffer (2X) 5 ul
- Deionized water 3 ul
6. Flush the wells several times with 1X running buffer
7. Load 10 ul of ladder and samples using gel loading tips
8. Run at 180 V for 90 min
9. Prepare stain
- Novex running buffer (1X) 75 ml
- SYBER Gold 7.5 ul
10. Stain gel for 10 minutes
11. Visualize get on UV tansluminator
Results:
HpaII digests for 4 individuals from each of 4 populations (pop names listed on 03.17.11)
03.17.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Pre-select and select PCR for DL rxns from 03.16.11
Methods:
Stopped DL rxns from yesterday by adding 145 ul of nuclease free H20 to each raction
Ran PS PCR (see below) and checked for smears on an agarose gel which were there. Then set up S PCR (see below) using same cocktail and cycling conditions as PS PCR with primer set 1 (Primer Pair 1: AAC_TTA).
Next Steps: Run S PCR on poly gel
03.16.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Digestion ligation reactions of population samples for HpaII only
Methods:
Made new HpaII/MspI and EcoRI adaptors see adaptor prep
Diluted EcoRI adaptor from 40pm/ul to 4pm/ul
Prepared fresh T4 ligase
449 ul H20
50 ul T4 ligase buffer (10x)
1 ul T4 liagse
Set up DL rxns and incubated overnight at 37C
03.11.11
Project: DNMT1 gene charcterization
Summary: Testing primer set B
Methods:
20ul PCR (x7)
10ul Apex Red Taq 70ul
0.6ul DNMT1_B F 4.2ul
0.6ul DNMT_B R 4.2ul
3.8 ul H20 26.6ul
5 ul template ---
Samples
1 coho cDNA 1 (from FISH441)
2 coho cDNA 2 (from FISH441)
3 sockeye Adult_1 DNA @ 200ng/ul (for PCR template used 2.5ul DNA and 2.5ul H20)
4 sockeye Adult_2 DNA @ 200ng/ul (for PCR template used 2.5ul DNA and 2.5ul H20)
5 negative
6 negative
Cycling conditions
94C 2 min
94C 30 sec
55C 2 min
72C 2.5 min
back to step 2 39 times
72C 10 min
4C hold
Results: to be determined
Next Steps:
Run on agarose gel. Test 2nd set of primers.
03.07.11
Project: DNMT1 gene charcterization
Summary: Designing primers for DNMT1 gene
Methods:
Designed two sets of primers of off O. mykiss sequences. The first of primers was designed to capture the entire sequence. The second set of primers is nested within the first set and was designed to capture a 100 bp region. For more detailed methods see my Evernote notebook.
Results:
Primer Set a (should amplify entire gene ~6000bp)
F: TGCCCAGGACCAGCTCAGCA
R: TCGCTACCCAGAGCCCCTGC
Primer Set b (should amplify 1000bp region of gene)
F: GTGCCCGCTTTGAGACCCCG
R: CCGCTGGCCCAGGGAGTTTG
03.03.11
Project: DNMT1 gene characterization in salmonids
Summary: BLASTs using D.rerio AA ref seq as query seq
Methods: See my Evernote notebook.
Results:
Wanted to assemble the entire DNMT1 gene sequence for O.nerka, but there are not enough sequence data (at least in the NCBI database) so I have been trying get the entire gene sequence for O.mykiss (rainbow trout). Although this has been much easier for O.mykiss it is not an easy task since the DNMT1 gene is 2000 AA long! I have some pretty sizable chunks of sequences 1000-200 bp, but they are not overlapping so I need to work on getting a better idea where the gaps are using the nucleotide DNMT1 seq for D.rerio
Next Steps: Search our local short read databases for more sequence
03.02.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Poly gel duo of products from 02.28.11 with a few modifications.
Methods:
Same poly gel methods as 03.01.11, except for a few changes:
- Only dilute ladder to 0.04ug/ul to try to get a stronger ladder signal. For ladder dilution: 1 ul of 50 bp DNA ladder (1ug/ul) and 24 ul of RNase free water.
- No denaturing step for samples
- Run gel for twice as long until second gel front (110 bp) is at the bottom of the gel
Results/Conclusions:
Ran gel for 90 minutes. Second gel front was at very very bottom of gel. A ran a different non-negative from yesterday. Ladder is the same as for 03.01.11. A's and B's are different digestion-ligation reactions.
The poly gel defiantly seems to provide better resolution than the agarose seen here from yesterday. I think that a longer poly gel is needed for genotyping. For Adult_4 Hpa I a and b look different which raises continued concerns about reproducibilty.
Next Steps: Get clean negatives? Investigate using a capillary machine for genotyoing?
03.01.11
Project: Population specific methylation patterns in sockeye salmonSummary: Ran agarose gel and poly gel of products from 02.28.11.
Methods:
Agarose Gel
Loaded 8 ul of sample on 1% Agarose gel at 70 V for ~1.5 h. Ladder (far left) isHyper1 from Bioline.
Novex 6% TBE-Urea Gel 1.0mm 10 wells (adapted from manufacturer's protocol)
1. Prepare 1X running buffer
- Novex TBE Running Buffer (5X) 200 ml
- Deionized water 800 ml
- 50 bp DNA ladder (1ug/ul) 1 ul
- RNase free water 49 ul
- Diluted ladder (0.02ug/ul) 5 ul
- Novex TBE Urea Sample Buffer (2X) 5 ul
- Sample 2 ul
- Novex TBE Urea Sample Buffer (2X) 5 ul
- Deionized water 3 ul
6. Set up gel rig
7. Flush the wells several times with 1X running buffer
8. Load 10 ul of ladder and samples using gel loading tips
9. Run at 180 V for 50 min
10. Prepare stain
- Novex running buffer (1X) 50 ml
- SYBER Gold 5 ul
12. Visualize get on UV tansluminator
Results:
Agarose Gel
The agarose gel shows inconsistently positive negative controls. The banding patterns for the samples are as expected when using the Apex taq MM. Gel photo can be seen here. Despite the poor negatives I am going to proceed with the poly gel in order to see what resolution a poly gel provides.
Novex 6% TBE-Urea Gel 1.0mm 10 wells
After a slow start finally got the gel running. Ladder info can be found here. Only one negative was run because there are only 10 wells in the pre-cast gels. Gel was run for 50 min until the first dye front had just migrated off of the gel. Also, I tore the top left corner of the gel when releasing it from the cassette.
Next Steps:
Going to rerun the poly gel for at least twice as long with the same samples. Will also try running it without the denaturing step. I am still concerned about the negatives though.
2.28.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Select PCR with primer pair 1 using Apex taq.
Methods: Same as on 01.26.11. Used Apez pre-select product from 02.07.11.
Next Steps: Run on agarose and poly gel.
02.23.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Repeated PCR from 02.17.11 to confirm bizzare results seen on 02.22.11 gel.
Methods: Same as on 02.17.11 (except that I only made up 20 ul rxns) and 02.22.11.
Results: Gel looks exactly the same (view here).
Next Steps: There is something currently unexplainable going on in the select PCR with the Immomix. There is a lot I could do to try and figure it out, but right now I am going to go back to the Apex Taq and run that pre-select product on a poly gel.
02.22.11
Project: Population specific methylation patterns in sockeye salmon AND DNMT gene chacterizationSummary: Began DNMT1 gene characterization and ran gel for select PCR from 02.17.11
Methods:
Gene Characterization
Started with AA ref seq for Danio rerio (gi|40538748|ref|NP_571264.1|)
Gel
Loaded 8 ul of sample (2ul of loading dye) on 1% Agarose gel at 90 V for ~1 h. Ladder (far left) is Hyper1 from Bioline.
Results:
Conclusions/Next Steps:
The gel is quite surprising. I expected clear banding patterns as I had observed in previous select PCR's using the Apez Taq MM. It is also odd that I have a rouge negative. I am going to redo this PCR to confirm these results and then think about troubleshooting.
02.17.11
Project: Population specific methylation patterns in sockeye salmonSummary: Ran products from 02.14.11 on a gel. Select PCR of all D-L pre-select products (using primer pair 1) with twice as large reactions so that the same product can be used for an agarose gel, polyacrlymide gel, and the bioanalyzer.
Methods:
Gel
Loaded 8 ul of sample (2ul of loading dye) on 1% Agarose gel at 70 V for ~1 h. Ladder (far left) isHyper1 from Bioline.
PCR
Select PCR of PS products from 02.14.11 and 02.09.11 using primer pair 1.
Results:
Gel of 02.14.11 PCR. Negative control is clean.
Next Steps: Run PCR product on all three platforms.
02.14.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Pre-select PCR of digestion-ligation sample 1. (I used all of the product previously on 02.10.11).
Methods:
Next Steps: Run product on gel to check for contamination. Perform select PCR.
02.10.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Gel from Immomix and GoTaq PCRs from 02.09.11.
Methods: Ran pre-select PCR products from 02.09.11 Immomix and GoTaq PCR reactions on a gel. Loaded 8 ul of sample (2ul of loading dye) on 1% Agarose gel at 70 V for ~1 h. Ladder (far left) isHyper1 from Bioline. Accidently loaded first sample without dye. Reloaded lane with sample and loading dye. Will have to re-PCR this sample now because there is not enough product left for downstream reactions.
Results: Immomix MM worked this time after an activation step was added to the thermocycling profile. WooHoo. However, the Immomix PCR product is not as bright as in the Apex PCR from 02.08.11 (Gel 2). Because nothing can be perfect, the smear in lane 1 of the Immomix PCR has a pretty high molecular weight. I am hoping this may be a result of the sample being double loaded once w/o loading dye and once w/ loading dye. The GoTar PCR does not look as good. It seems strange there are such drastic differences between these different Taqs.
Next Steps: Re-pcr sample 1 (Adult4 Msp II a) because there is no more PCR product left. Perform select PCR using primer pair 1 with double the reaction volume so that there is enough product to use across multiple platforms for visualization.
02.09.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Immomix and GoTaq PCR (w/ heat activation step included this time). Trying to see if I get successful amplification using different taqs, specifically ones without loading dyes.
Methods:
PCR protocol is the same as on 01.26.11 except that I am using two different Taq Master Mixes Bioline Immomix (2X) and Promega qPCR GoTaq (2X).
Cycling conditions are the same as on 01.26.11 expect for the addition of an initial heat activiation step of 95C for 10 min.
Next Steps: Run samples on agarose gel
02.08.11
Project: Population specific methylation patterns in sockeye salmonSummary: One gel, two gels, but not three gels.
Methods: Ran new pre-select PCR products from 02.07.11 Immomix and Apex PCR reactions on a gel. Loaded 8 ul of sample on 1% Agarose gel at 60 V for ~1 h. Ladder (far left) is Hyper1 from Bioline. Also ran old select PCR products from 02.01.11 (same samples that were run on Bioanalyzer on 02.03.11) on a gel. Loaded 10 ul of product on 1% Agarose gel at 70 V.
Results:
For Gel 2 I must have forgot the template for Adult_4 Hpa I b. In Apex reactions bands are smeary as expected. No amplification in the the Immomix samples. However, I just noticed that Immomix is a hot start Taq so the lack of bands could be the result of there not being an activation step in the thermocycling conditions.
No surprises with gel 1. Negatives look just as contaminated as they did on the bioanalyzer. Contamination is probably in the pre-select PCR product.
Next Steps: Try other Taqs? Re-run Immomix PCR with hot-start.
Gel 1
PCR product from 02.01.11 (same product run on Bioanalyzer chip on 02.03.11).
Gel 2
PCR products from 02.07.11 using Immomix and Apex Taq MM
02.07.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Testing different Taq Polymerases and redoing pre-select PCR (where negatives git contaminated). Worried that loading dye in Apex Red may interfere with Bioanalzer.
Methods: Ran pre-select PCR (amplifies any DNA fragment with an adaptor attached) for primer pair 1 using digestion-ligation reactions from 01.25.11. Used both Apex Red polymerase (as before) and Bioline's Immomix (no dye). PCR protocol and thermocycling conditions same as 01.26.11.
Next Steps: Run on gel.
02.03.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Ran PCR products from 02.01.11 on Bioanalyzer DNA 1000 chip
Methods:
Followed manufacturer's instructions found here. Gel-Dye mix had been made when the kit was first received.
Results: Well for starters, my negative controls are not negative. There does appear to be some decent reproducibility between samples from different digestion-ligation reactions (e.g. different tubes, same enzymes) for example the Adult_4 Msp II samples (a & b) are pretty darn similar. The scale and signal from the internal standard is variable. I need to figure out if I can adjust for this in the software. In several cases the standard signals were so week that I had to manual call them as the high and low standard. One cool thing is that you can overlay florescence plots from different samples. I wonder if you can combine raw data files from several different chips?
Take away messages:
- I can defianattly "genotype" based on presence or absence of peaks.
- Some tweakeing may be needed. Q: Does the dye from the Apex Red Taq MM interfere at all?
- There are still some concerns about reproducibilty
- Need clean negatives
Next Steps:
Run these same samples on agarose gel. Redo PCR with larger reaction volume so that I can use the same product for an agarose gel, bioanalyzer chip, and polyacrleymide gel. Get clean negatives. Will also start testing out different Taqs that do not contain a loading dye.
Bioanalyzer 020311
View more presentations from cgstorer.
02.02.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Ran gel for PCR products from 01.31.11 (primer pairs 6 & 7)
Methods: Entire sample run on reused 1% Agarose gel at 60 V for ~2 h. Ladder (far left) is Hyper1 from Bioline.
Results: Smeary, faint, and not necessarily reproducible. The banding patterns from the different digestion/ligation rxns (same sample and same enzyme) look different. I wonder if this is more apparent because I ran this gel for longer (hence the product running into the second row of wells) resulting in better separation of the bands.
02.01.11
Project: Population specific methylation patterns in sockeye salmon
Summary: PCR using primer pair 1 for polyacrleymide gel and Bioanalyzer chip.
Methods:
Same as on 01.26.11.
01.31.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Testing last two MS-ALFP primer pairs to identify the most informative ones.
Methods: Same as on 01.26.11.
Primers (highlighted)
| EcoR I primers |
Hap II/Msp I primers |
|
| Primer pair 1 AAC_TTA |
5'-GACTGCGTACCAATTCAAC |
5'-ATCATGAGTCCTGCTCGGTTA-3' |
| Primer pair 2 ACA_TTC |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTTC-3' |
| Primer pair 3 ACA_TGA |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTGA-3' |
| Primer pair 4 ACA_TGT |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTGT-3' |
| Primer pair 5 ACA_TGC |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTGC-3' |
| Primer pair 6 ACA_TAC |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTAC-3' |
| Primer pair 7 ACG_TCG |
5'-GACTGCGTACCAATTCACG |
5'-ATCATGAGTCCTGCTCGGTCG-3' |
Next Steps: Run products on agarose gel.
01.28.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Testing remaining MS-ALFP primer pairs to identify the most informative ones.
Methods: Same as on 01.26.11. The entire sample (20ul) was run out on a 1% agarose gel at 60 V for ~ 90 minutes. Ladder (far left) is Hyper1 from Bioline.
Primers (highlighted)
| EcoR I primers |
Hap II/Msp I primers |
|
| Primer pair 1 AAC_TTA |
5'-GACTGCGTACCAATTCAAC |
5'-ATCATGAGTCCTGCTCGGTTA-3' |
| Primer pair 2 ACA_TTC |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTTC-3' |
| Primer pair 3 ACA_TGA |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTGA-3' |
| Primer pair 4 ACA_TGT |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTGT-3' |
| Primer pair 5 ACA_TGC |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTGC-3' |
| Primer pair 6 ACA_TAC |
5'-GACTGCGTACCAATTCACA |
5'-ATCATGAGTCCTGCTCGGTAC-3' |
| Primer pair 7 ACG_TCG |
5'-GACTGCGTACCAATTCACG |
5'-ATCATGAGTCCTGCTCGGTCG-3' |
Results: Need better resolution. Replicates (different digests, same template) for primer pair 2 may not have the same banding pattern. It does look like there are some scorable genotypes in primer pairs 3 and 5.
Next Steps: Test last two primer pairs and run samples on polyacrleymide gel.
01.27.11
Project: Population specific methylation patterns in sockeye salmon
Summary: 01.26.11 samples run on a gel. Trying to see if results are reproducible.
Methods:
The entire sample (20ul) was run out on a 1% agarose gel at 60 V for ~ 90 minutes. Ladder (far left) is Hyper1 from Bioline. Largest band is 10,000 bp and smallest band is 200 bp.
Results:
Each lane (except for negatives) represents a different digestion-ligation reaction. That one horrible negative aside, it looks like similar results are yielded from different D-L reactions.
Next Steps: Test the remaining primer pairs. Look into running a polyacrleymide gel and research bioanalyzer costs.
01.26.11
Project: Population specific methylation patterns in sockeye salmon
Summary: Pre-select and select PCR using D-L reaction products from 01.25.11
Methods: No additional MgCl2 was used in these reactions based on my results from 01.21.11
Pre-select PCR (amplifies any fragment that has an adapter attached to it)
PCR is the same as above, but with AAC_TTA primer pair.
Next Steps: Run gel.
01.25.11
Project: Population specific methylation patterns in sockeye salmonSummary: Performing a new digestion/ligation reaction with same samples (Adult_4 & Juv_4) from 01.13.11 to see if MS-AFLP banding patterns are reproducible.
Methods:
New adapters do not have to be remade. The digestion/ligation protocol is the same as on 01.13.10.
01.21.11
Project: Population specific methylation patterns in sockeye salmon (STILL NEW!)Summary: Before trying to move on to more sensitive visualization techniques such as polyacrylamide gels or maybe even the bioanalyzer I am trying to optimize the select PCR. I tested 5 different concentrations of MgCl2
Methods:
Used samples 1 (Adult_4 MSPI), 2 (Adult_4 HPAII), and 5 (negative) from the preselect PCR on 01.14.11 and the AAC/TTA primer pair. Cycling parameters were also the same as o n 01.14.11.
The entire sample (20ul) was run out on a 1% agarose gel at 60 V for ~ 90 minutes. Ladder (far left) is Hyper1 from Bioline. Largest band is 10,000 bp and smallest band is 200 bp.
Results: Selcet PCR was succsessful as anticipated. Banding is a lot clearing across the board than on 01.14.11 because a wider comb was used and more sample was loaded.
In the previous preselect PCR (01.14.11) the MgCl2 concentration was 4.5 nM in the final reaction. Here is looks like the optimal concentration is actual much lower. In the future I will perform all PCR's with a final concentration of 1.5 nM of MgCl2 which means that additional MgCl2 does not need to be added.
Next Steps: There are several possibilities for more sensitive and quantifiable method for analyzing banding patterns. I would like to try running a few samples on the Bioanalyzer using the DNA1000 chip which can hold 12 samples. I would like to run the same sample in duplicate for each digestion/ligation, so on one chip I could run 4 samples. I am also concerned about background from the Apex and the reproducibility of the results. Would I observe the same banding patterns for the same sample if the product was from a different digestion/ligation reaction? I think the I can run the Apex MM on the chip to account for any background.
I think my first step from here will be to perform re-perform the entire MS-AFLP procedure on the same two samples. Then I will run these products in duplicate on the DNA a chip with my previously digested products from 01.13.11 that have amplified in pre-select and select PCR.
01.17.11
Project: Rapid senescence and telomere length in Hansen Creek sockeye salmon
Summary: Telomere assay test 4.0. Using less Tel1b and Tel1b primer than 01.10.11 and more template DNA for elongation factor.
Methods:
Telomere MM
12.5 ul Immomix
0.1 ul Tel2b
0.1 ul Tel1b
1 ul Syto13
8.8 ul nuclease free H2O
2.5 ul of template DNA ( of 20ng/ul stock)
Elongation Factor MM
12.5 ul Immomix
0.1 ul EF1a_ F
0.1 ul EF1a_ R
1 ul Syto13
10.3 ul nuclease free H20
1.0 ul of template DNA (of 200 ng/ul stock)
Cycling paramters are the same as on 01.10.10
Plate layout can viewed on the full report in Results
Results: Full qPCR report is here and a picture of the amp plots are below. Curious results. Elongation factor amplification plots look good. The melt curve is not very clean, but this could be do to the slow ramp rate from the HRM. Now the telomere assay, run with less primer (0.04 uM per a reaction instead of 1uM as on 01.10.11) and 2ng of DNA per rxn, still looks funky. There is no longer exponential amp at cycle 15(~) just a small increase in florescence and then a decrease in fluorescence (falling below zero!). Exponential amplification begins again around cycle 38.
I am not sure that I understand the chemistry and kinetics of the telomere assay well enough hypothesize what is going on. I think it could be possible that the early amp we have seen may be primers annealing to themselves and that we need to optimize the assay to target the amplification that is occurring at latter cycles.
Next Steps: I am going to e-mail the author of telomere assay paper to see if he can provide some insight.
01.14.11
Project: Population specific methylation patterns in sockeye salmon (STILL NEW!)
Summary: MS-AFLP day 2 (from 01.13.11). Pre-select PCR, which amplifies any template with an adapter attached, and select PCR.
Methods:
Pre-select PCR
Select PCR
Primer Pair 1: AAC_TTA
Primer Pair 2: ACA_TTC
Same cocktail mix as pre-select PCR with samples run in duplicate
Ran samples on 1% agarose gel
Results:
It worked (see picture below)! Replicates are the same unlike in when this procedure was tried on the Pacific oyster. There is a difference between the methylation insensitive restriction enzyme (Msp II) and the methylation sensitive enzyme (HpaI). This means that there is methylation. Further interpretion of these results and how they can be used to define population sepcififc methylation patterns is needed.
Next Steps: A few things I can begin working on are to optimize the pcr to get cleaner bands, replicate the entire experiment from the initial digestion/ligation, and try running the samples on a polyacrylamide gel to get better resolution. I will investigate the possibility on running samples on capillary machine used to genotype mircosats.
Ladder (far left) is Hyper1 from Bioline. Largest band is 10,000 bp and smallest band is 200 bp.
01.13.11
Project: Population specific methylation patterns in sockeye salmon (NEW!)
Summary: Began MS-AFLP protocol developed by Mac and found on the lab protocol page. This protocol has been adapted from Li et al. 2008. I will only be using two samples for this first test. Each sample will be run in duplicate for each digestion/ligation reaction and primer pair.
Methods:
Adapter Prep
Prepared double stranded adapter stock to be used in all subsequent MS-AFLP procedures.
Digestion/Ligation Reaction
Prepared dilutions of T4-liagse and EcoRI adapter (from stock made above) using MS-AFLP protocol.
Prepared the following the following digestion/ligation reactions:
Incubated reactions at 37C overnight
Next Steps: Complete MS-AFLP and visualize products on gel. I will probably only run the selective PCR for 2 or 3 primer pairs instead of all 7.
01.10.11
Project: Rapid senescence and telomere length in Hansen Creek sockeye salmon
Summary: Telomere Assay Test 3.0. Running telomere assay similarly to 12.08.10 but with a lower concentration of template DNA and a high resolution melt curve (i.e. slower ramp rate). This time I will be using a real normalizing gene: elongation factor
Methods: All reactions are 25 ul in volume
Telomere MM
12.5 ul Immomix
0.25 ul Tel2b
0.25 ul Tel1b
1 ul Syto13
8.5 ul nuclease free H2O
2.5 ul of template DNA ( of 20ng/ul stock)
Elongation Factor MM
12.5 ul Immomix
0.1 ul EF1a_ F
0.1 ul EF1a_ R
1 ul Syto13
8.8 ul nuclease free H20
2.5 ul of template DNA (of 20ng/ul stock)
Cycling paramters are the same as on 12.08.10 except for slower ramp rate during melt.
Plate Layout:
Results: A full qPCR report with amplification plots and melt curves can be found here. The amp plots for the telomere assay still funky with early amplification and a second exponential phase. Also there is amplification, albeit really late in the negative controls. The melt curves look okay though. The amplification plots for elongation factor look alright, however the melt curves look downright disgusting. I am not really sure why and will cunsult about it.
Next Steps: Make some adjustment then run it again. I think I will defiantly scale down the amount of primer in the telomere assay.
12.21.10
Project: Characterizing genes and SNPs in DNA methylation pathway in sockeye salmonSummary: Prepped samples for sequencing.
Methods: Made and plated 3uM F and R primer stock for cycle sequencing reaction. Plated diluted PCR product with 5ul of NanoPure H20. Samples were shipped UW's core sequencing lab by Carita.
Next Steps: Analyze sequence results
12.20.10
Project: Characterizing genes and SNPs in DNA methylation pathway in sockeye salmonSummary: HRM of 20 primers with successfully amplified products from 11.29.10.
Methods: Using same PCR protocol as on 11.29.10. Reaction cocktail and HRM conditions are as follows.
LC480 High Resolution Melt (HRM)
Temp Time
95 C 1 min
40 C 1 min
62 C 1 sec
0.02 C/sec ramp rate to 96C
For each primer pair (one primer pair per column) I ran 14 samples. 10 of the samples were the same fish used for SOLiD transcriptome sequencing and the remaining 4 were from my Hansen Creek adult sockeye samples from 12.07.10
Results: Only eight primers pairs were selected on sequencing based on the HRM profiles. All of these primers were designed from transcriptome consensus sequences BLASTed to gene sequences of interest. Because many of these transcriptome sequences had multiple hits (see BLAST query sheet) I will BLAST the sequenced product to confirm gene identity. Based on the primer test I had anticipated to have more primer pairs to send for sequencing, but HRM can be pretty sensitive to minute differences in template quality and reaction concentration possibly explaining why so many of the HRM profiles looked worse then the melt profiles from primer testing on 11.29.10. Because many of the sequences that primers were designed off of had multiple blast hits it is likely that more than one product is being amplified.
Next Steps: Prep samples for sequencing.
12.08.10
Project: Rapid senescence and telomere length in Hansen Creek sockeye salmonSummary: Telomere Assay 2.0 with two different concentrations of primers (see Methods), a lowering annealing temperature, and a new "normalizing gene".
Methods: Made two master mixes one following the Callicott and Womak (2006) with 300 nM (MM 1) of each telomere primer in the final reaction and one following O'Callaghan et al (2008) which had 100nM (MM 2) of primer in the final reaction. I just used a primer pair I knew would work for the single copy gene, not a true normalizing gene. It was primer pair Onerka_79419 which is for a DNA methyltransferase gene from my DNA methylation project.
25 ul reactions
Telomere MM 1
12.5 ul Immomix
0.75 ul Tel2b
0.75 ul Tel1b
1 ul Syto13
7.5 ul nuclease free H2O
2.5 ul of template DNA (of 200ng/ul stock)
Telomere MM 2
12.5 ul Immomix
0.25 ul Tel2b
0.25 ul Tel1b
1 ul Syto13
8.5 ul nuclease free H2O
2.5 ul of template DNA (of 200ng/ul stock)
Single copy gene MM
12.5 ul Immomix
0.1 ul Onerka_79419 F
0.1 ul Onerka_79419 R
1 ul Syto13
8.8 ul nuclease free H20
2.5 ul of template DNA (of 200ng/ul stock)
Cycling Parameters
95C 10 m
95C 15 s
56C 1 m
72C 10 s back to 95C for 40 cycles
95C 5s
65C 5 s
65-95C melt
Plate Layout
Results: There was amplification in every sample for all primer pairs. This is good. The amp and plots for the "normalizing" gene look good. The telomere MM with the lower primer concentration definitely looks better. In both telomere assays the Ct is really low with exponential amplification starting around cycle 14. Also, around cycle 39/40 it looks like there is a second exponential amplification phase which is odd. I also my try using less primer even though this was the concentration used by O'Callaghan et al (2008).
Next Steps: I will retry the temlomere assay using MM2, but with a lower concentration of template DNA. I will also run a true normalizing gene since this one was just a randomly selected primer pair that I knew would work.
12.07.10
Project: Rapid senescence and telomere length in Hansen Creek sockeye salmonSummary: DNA extraction, quantification, and telomere assay test numero Uno.
Methods: Finished Qiagen DNA extraction from 12.07.10. DNA was eluted in 100ul of provided elution buffer. Samples were quantified on the Nanodrop 1000 (see results here) and made 50 ul of working stock at 200ng/ul.
Telomere Assay 1.0: Telomere primers and rS2 primers (single copy gene primers from 12.04.10
Adapted from Callicott and Womak (2006) for 25 ul reactions
Telomere MM
12.5 ul Immomix
0.75 ul Tel2b
0.75 ul Tel1b
1 ul Syto13
7.5 ul nuclease free H2O
2.5 ul of template DNA (@200ng/ul)
Single copy gene MM
12.5 ul Immomix
0.1 ul On_rS2_F
0.1 ul On_rS2_R
1 ul Syto13
8.8 ul nuclease free H20
2.5 ul of template DNA (@200ng/ul)
Cycling Parameters
95C 10 m
95C 15 s
50-60C 1 m to 95C for 40 cycles
95C 10 s
65C 5 s
65-95C melt
Plate Layout:
Results: No amplification across the board. Probably due to a few things including cycling parameters.
Next Steps: Try again with a more traditional cycling profile and a lower annealing temp. The one I used here was straight out of the literature. Due to time constraints I am not going to fiddle with optimizing the sR2 assay and instead use a primer pair I know works for normalization.
12.06.10
Project: Rapid senescence and telomere length in Hansen Creek sockeye salmonSummary: Sockeye salmon DNA extraction
Methods: Began DNA extractions using Qiagen DNeasy (using manufacturer's protocol) from adult fish (n=4) and juvenile sockeye salmon (n=4).
Next Steps: Finish DNA extraction, quantify DNA, and run telomere assay.
12.04.10
Project: Rapid senescence and telomere length in Hansen Creek sockeye salmonSummary: Ordered primers for telomere assay
Methods: Two sets of primers are needed, one that hybridizes to the telomere and one for a single copy gene. Finding a single copy gene in salmonids is difficult due to polyploidy and the lack of genome, however Hiraoka et al. claim to have determined the ribosomal protein S2 is a single copy gene using blotting techniques. I used the cDNA sequence from their paper to design primers for this gene using Primer3.
On_rS2_TelomereAssay_R CACATGGCCGTTGTAGTCAC from Callicott & Womack 2006
On_rS2_TelomereAssay_F CAAGTCCGAGGACAAGGAAT from Callicott & Womack 2006
Tel2b_TelomereAssay GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT from Hiraoka et al. 1997
Tel1b_TelomereAssay CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT from Hiraoka et al. 1997
Next Steps: Test the telomere assay primers on adult and juvenile sockeye salmon.
11.29.10
Project: Characterizing genes and SNPs in DNA methylation pathway in sockeye salmonSummary: Testing primers from 11.09.10 using pooled sockeye DNA as template and PCR.
Methods: Used the Applied Biosystems Verti for PCR and the Roche Lightcycler 480 for melting with the protocol below.
Results: The results of the primer test can be viewed here in the sheet named "Primer Test". Good amplification products a clean single melt curve and okay amplification products had a single somewhat dirty melt peak. Poor amplification products had either multiple melt curve peaks and/or were very dirty.
Next Steps: Using the primers of either I will be picking a test panel of fish for HRM and sequencing for the.
Update: Will run HRM with same fish use SOLiD sequencing
11.09.10
Project: Characterizing genes and SNPs in DNA methylation pathway in sockeye salmonSummary: 42 primer pairs ordered!!
Methods: 19 primers were designed from consensus de novo sockeye top hits for tblastn with MeM AA seqs and the remaining are from sockeye short reads assembled onto genes of interest. Primer3 batch was used. Primers and primer seqs can be seen here on the sheet named "Primers".
Next Steps: Primers will be tested on pooled sockeye salmon DNA.
11.01.10
Project:Summary: 152 D. rerio methylation machinery (MeM) genes were identfyed using the KEGG pathway shown below.
The AA seqs of these152 genes were used to identfying MeM genes in O.nerka by doing the following using the CLC Genomics Workbench:
- tblastn using 152 MeM genes (AAseqs) and NCBI O.nerka EST and mRNA archives Location:CLC_flatfile/Roberts/Storer/methylation machinary/DanioPath_blast_NCBI
- tblastn using 152 MeM genes (AAseqs) and O.nerka trimmed SOLiD seqs Location:CLC_flatfile/Roberts/Storer/methylation machinary/DanioPath_blast_solidassemb
- O.nerka trimmed SOLiD sequences mapped to 42 D. rerio MeM nucleotide seqs Location:CLC_flatfile/Roberts/Storer/methylation machinary/REF_DanioMethy
10.25.10
Project: Characterizing genes and SNPs in the DNA the methylation pathway in sockeye salmonSummary: Selecting 40 genes from pathways involving DNA methyltransferases and telomerase for SNP pathway characterization and SNP discovery in sockeye salmon.
DNA methyltransferase identified in 2 KEGG pathways:
Cysteine and methionine metabolism (ec00270; see below) and Metabolic pathways (ec01100)
Steven had previously assembled all 8 sockeye solid runs to D. rerio nucleotide sequences from the cysteine and methionine metabolism pathway (at least I think that is what he did, I will re-run this assembly on my own anyway). I exported a fasta of the 41 reference sequences for these genes from that assembly to be used for primer design.
Before moving ahead with primer design, I will be checking each assembly to look at the coverage and depth of the sockeye reads in the hopes of identify conserved regions for primer design (as apposed stretches of repeated sequence motifs). Additionally, I might also try to identify homologous sequences in species closely related to sockeye salmon